Mutagenetix > Incidental Mutation

Incidental Mutation 'R8013:Ext1'

617028

Institutional Source

Beutler Lab

Gene Symbol

Ext1

Ensembl Gene

ENSMUSG00000061731

Gene Name

exostoses (multiple) 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8013 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53064038-53346159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53075887 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 589 (I589V)

Ref Sequence

ENSEMBL: ENSMUSP00000076505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]

AlphaFold

P97464

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077273
AA Change: I589V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: I589V

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
low complexity region	29	41	N/A	INTRINSIC
Pfam:Exostosin	110	396	6e-64	PFAM
Pfam:Glyco_transf_64	480	729	1.1e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133362

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	G	6: 149,328,870	V1138G	probably damaging	Het
6030458C11Rik	C	A	15: 12,824,529	D7Y	probably benign	Het
9530053A07Rik	G	A	7: 28,137,541	R295H	probably benign	Het
Ahnak	A	G	19: 9,009,335	D2661G	unknown	Het
Akap13	G	A	7: 75,730,465	R462H	probably damaging	Het
Apob	T	A	12: 8,010,798	N3093K	possibly damaging	Het
Baz2a	C	T	10: 128,125,288	R1627C	probably benign	Het
Baz2a	T	G	10: 128,125,292	V1628G	possibly damaging	Het
Bbs7	A	T	3: 36,594,387	I404K	probably damaging	Het
BC030867	A	G	11: 102,257,899	N379D	probably benign	Het
Cacna1g	T	C	11: 94,456,970	Y764C	probably damaging	Het
Casr	G	A	16: 36,509,644	L443F	probably benign	Het
Cfap43	T	A	19: 47,773,109	I849F	probably damaging	Het
Cntn3	A	T	6: 102,199,317	H812Q	probably benign	Het
Cog1	A	G	11: 113,656,164	D528G	probably damaging	Het
Depdc5	C	T	5: 32,973,842	T1229M	probably benign	Het
Dis3	T	A	14: 99,077,399	R954W	possibly damaging	Het
Disp2	T	A	2: 118,789,682	Y298*	probably null	Het
Dock2	A	C	11: 34,705,850	I393S	probably damaging	Het
Dtd1	A	G	2: 144,617,332	D92G	probably damaging	Het
Eef2	T	A	10: 81,178,196	V121D	probably damaging	Het
Eml1	T	A	12: 108,521,679	I550N	probably benign	Het
Entpd7	A	G	19: 43,728,055	D496G	probably benign	Het
Ets2	T	A	16: 95,716,100	L292Q	probably damaging	Het
Fam20a	T	A	11: 109,685,506	E142D	possibly damaging	Het
Farp1	T	A	14: 121,242,401	I368N	probably damaging	Het
Fars2	C	T	13: 36,205,085	Q186*	probably null	Het
Fbn2	T	C	18: 58,104,081	T617A	possibly damaging	Het
Fbxo38	T	C	18: 62,530,811	E203G	possibly damaging	Het
Fhdc1	A	T	3: 84,474,639	M1K	probably null	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gm28363	A	G	1: 117,726,804	R58G	probably benign	Het
Gm8356	A	T	14: 6,536,303	N58K	probably damaging	Het
Grsf1	A	G	5: 88,675,756		probably null	Het
Hephl1	T	A	9: 15,054,609	D1016V	possibly damaging	Het
Kcnma1	T	A	14: 23,373,143	I831F	probably benign	Het
Krt78	T	C	15: 101,948,542	R377G	probably damaging	Het
Lama2	T	C	10: 27,344,498	H457R	probably benign	Het
Lmnb1	T	A	18: 56,708,359	Y83N	probably damaging	Het
Loxl4	A	G	19: 42,607,676	C113R	probably damaging	Het
Lrba	A	T	3: 86,417,971	D1912V	probably damaging	Het
Macf1	T	A	4: 123,526,826	T212S	probably benign	Het
Map3k4	A	T	17: 12,271,031	C504*	probably null	Het
Map4k4	T	C	1: 39,962,212	I53T	unknown	Het
Myo5b	C	T	18: 74,760,899	Q1700*	probably null	Het
Npas2	T	C	1: 39,338,065	F503L	probably benign	Het
Nrg1	A	T	8: 31,949,923	S149T	probably benign	Het
Olfr1243	A	G	2: 89,527,936	V158A	probably benign	Het
Olfr155	T	A	4: 43,854,958	F216L	probably benign	Het
Olfr697	C	T	7: 106,741,617	V106I	probably benign	Het
Olfr824	T	A	10: 130,126,778	K93M	probably damaging	Het
Pdia6	T	C	12: 17,273,965	L66S	probably damaging	Het
Prss35	T	C	9: 86,755,425	S83P	probably damaging	Het
Psme4	G	A	11: 30,804,320	M192I	probably benign	Het
Ptprs	A	C	17: 56,435,994	S383A	probably damaging	Het
Sar1b	C	T	11: 51,779,794	P55L	possibly damaging	Het
Sgsh	A	G	11: 119,352,695	V67A	probably damaging	Het
Slc16a4	A	G	3: 107,311,478	Y465C	probably damaging	Het
Soga1	A	G	2: 157,030,786		probably null	Het
Stard9	T	C	2: 120,688,101	I502T	probably damaging	Het
Sugp2	T	A	8: 70,251,642	Y610N	probably damaging	Het
Tbc1d24	G	A	17: 24,182,821	P385S	possibly damaging	Het
Tm4sf1	T	C	3: 57,292,898	I99V	probably benign	Het
Tpr	G	T	1: 150,398,608	V163L	probably benign	Het
Usp31	T	C	7: 121,649,257	S988G	probably damaging	Het
Wdr63	T	C	3: 146,081,285	T332A	probably damaging	Het
Zbtb26	T	A	2: 37,437,001		probably null	Het
Zfp536	T	C	7: 37,569,610	N127S	probably damaging	Het
Zfp750	T	A	11: 121,513,017	D344V	possibly damaging	Het
Zmym5	T	A	14: 56,794,426	K408N	possibly damaging	Het

Other mutations in Ext1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00710:Ext1	APN	15	53344873	missense	probably damaging	1.00
IGL02081:Ext1	APN	15	53073446	nonsense	probably null
IGL03147:Ext1	UTSW	15	53088072	missense	probably damaging	0.98
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0047:Ext1	UTSW	15	53345146	missense	probably benign
R0437:Ext1	UTSW	15	53106106	missense	probably damaging	1.00
R0881:Ext1	UTSW	15	53344483	missense	probably benign	0.23
R1882:Ext1	UTSW	15	53075792	missense	probably damaging	1.00
R2135:Ext1	UTSW	15	53101744	missense	possibly damaging	0.88
R2175:Ext1	UTSW	15	53068728	missense	probably damaging	1.00
R2762:Ext1	UTSW	15	53344927	missense	probably benign	0.29
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3162:Ext1	UTSW	15	53344604	missense	possibly damaging	0.82
R3752:Ext1	UTSW	15	53075910	missense	probably damaging	1.00
R3815:Ext1	UTSW	15	53345089	missense	probably benign	0.05
R4096:Ext1	UTSW	15	53073357	missense	probably damaging	1.00
R4298:Ext1	UTSW	15	53345125	missense	probably benign	0.02
R4362:Ext1	UTSW	15	53107591	intron	probably benign
R4550:Ext1	UTSW	15	53101786	missense	probably damaging	0.99
R4647:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4648:Ext1	UTSW	15	53089987	missense	possibly damaging	0.95
R4871:Ext1	UTSW	15	53092377	missense	probably benign	0.37
R4954:Ext1	UTSW	15	53344492	missense	probably damaging	1.00
R5010:Ext1	UTSW	15	53092412	missense	probably damaging	1.00
R5153:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5155:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5328:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5385:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5542:Ext1	UTSW	15	53075817	missense	probably damaging	1.00
R5555:Ext1	UTSW	15	53088143	missense	probably damaging	1.00
R5779:Ext1	UTSW	15	53344553	missense	probably damaging	0.99
R5874:Ext1	UTSW	15	53101752	missense	possibly damaging	0.61
R6401:Ext1	UTSW	15	53106097	missense	possibly damaging	0.94
R6604:Ext1	UTSW	15	53083159	missense	probably damaging	0.99
R6847:Ext1	UTSW	15	53345154	missense	probably benign
R6885:Ext1	UTSW	15	53101692	missense	probably damaging	1.00
R7212:Ext1	UTSW	15	53345162	missense	probably benign	0.00
R7315:Ext1	UTSW	15	53073387	missense	probably damaging	1.00
R7361:Ext1	UTSW	15	53344723	missense	probably damaging	1.00
R7474:Ext1	UTSW	15	53344489	missense	probably damaging	0.98
R7853:Ext1	UTSW	15	53107485	missense	probably damaging	0.96
R7860:Ext1	UTSW	15	53089939	missense	possibly damaging	0.84
R8014:Ext1	UTSW	15	53075887	missense	possibly damaging	0.78
R8725:Ext1	UTSW	15	53344669	missense	possibly damaging	0.91
R8888:Ext1	UTSW	15	53092327	missense	probably damaging	1.00
R9162:Ext1	UTSW	15	53345108	nonsense	probably null
R9342:Ext1	UTSW	15	53345128	missense	probably benign
R9587:Ext1	UTSW	15	53092412	missense	possibly damaging	0.53
R9663:Ext1	UTSW	15	53345060	missense	probably damaging	0.96
R9753:Ext1	UTSW	15	53344671	missense	probably damaging	1.00
X0021:Ext1	UTSW	15	53345273	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGTTGTTAGAAATCTCAGCTC -3'
(R):5'- TGCAGGGCAAAATGTCAAGC -3'

Sequencing Primer
(F):5'- TGTTAGAAATCTCAGCTCCGGGC -3'
(R):5'- GTCAAGCAGTCAGTTTAATTTGCTG -3'

Posted On

2020-01-23