Incidental Mutation 'R8013:Tbc1d24'
ID617033
Institutional Source Beutler Lab
Gene Symbol Tbc1d24
Ensembl Gene ENSMUSG00000036473
Gene NameTBC1 domain family, member 24
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24175431-24209387 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24182821 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 385 (P385S)
Ref Sequence ENSEMBL: ENSMUSP00000128868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040474] [ENSMUST00000097376] [ENSMUST00000167791] [ENSMUST00000168378] [ENSMUST00000168410] [ENSMUST00000171189] [ENSMUST00000201089] [ENSMUST00000201301] [ENSMUST00000201359] [ENSMUST00000201583] [ENSMUST00000201805] [ENSMUST00000201960] [ENSMUST00000202853] [ENSMUST00000202925]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040474
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036458
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097376
AA Change: P391S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094989
Gene: ENSMUSG00000036473
AA Change: P391S

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167791
AA Change: P391S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127005
Gene: ENSMUSG00000036473
AA Change: P391S

DomainStartEndE-ValueType
TBC 42 259 8.6e-6 SMART
TLDc 342 556 7.6e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168378
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126107
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168410
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128868
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000171189
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128001
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201089
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144250
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201301
AA Change: P391S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143949
Gene: ENSMUSG00000036473
AA Change: P391S

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201359
SMART Domains Protein: ENSMUSP00000144026
Gene: ENSMUSG00000036473

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
Blast:TLDc 283 321 2e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000201583
AA Change: P42S

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144097
Gene: ENSMUSG00000036473
AA Change: P42S

DomainStartEndE-ValueType
TLDc 1 182 5.2e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000201805
AA Change: P391S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143883
Gene: ENSMUSG00000036473
AA Change: P391S

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
TLDc 342 556 7.8e-82 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201960
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144208
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202853
SMART Domains Protein: ENSMUSP00000144462
Gene: ENSMUSG00000107169

DomainStartEndE-ValueType
TBC 42 259 8.8e-6 SMART
Blast:TLDc 283 321 4e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000202925
AA Change: P385S

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144575
Gene: ENSMUSG00000036473
AA Change: P385S

DomainStartEndE-ValueType
TBC 42 259 1.78e-3 SMART
TLDc 336 550 2.21e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a conserved domain, referred to as the TBC domain, characteristic of proteins which interact with GTPases. TBC domain proteins may serve as GTPase-activating proteins for a particular group of GTPases, the Rab (Ras-related proteins in brain) small GTPases which are involved in the regulation of membrane trafficking. Mutations in this gene are associated with familial infantile myoclonic epilepsy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fbxo38 T C 18: 62,530,811 E203G possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Tbc1d24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Tbc1d24 APN 17 24185828 missense probably damaging 1.00
IGL01511:Tbc1d24 APN 17 24181918 missense probably benign 0.00
IGL02499:Tbc1d24 APN 17 24207619 splice site probably null
IGL02706:Tbc1d24 APN 17 24185421 missense probably benign 0.32
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1464:Tbc1d24 UTSW 17 24181223 critical splice donor site probably null
R1529:Tbc1d24 UTSW 17 24185979 missense probably damaging 1.00
R1985:Tbc1d24 UTSW 17 24207964 nonsense probably null
R1987:Tbc1d24 UTSW 17 24206872 missense possibly damaging 0.94
R2425:Tbc1d24 UTSW 17 24186008 missense probably damaging 0.99
R2902:Tbc1d24 UTSW 17 24207246 missense probably benign 0.01
R4622:Tbc1d24 UTSW 17 24208891 missense probably benign 0.03
R4946:Tbc1d24 UTSW 17 24208536 missense possibly damaging 0.94
R5428:Tbc1d24 UTSW 17 24181772 missense probably benign 0.34
R5890:Tbc1d24 UTSW 17 24185526 missense probably damaging 1.00
R5991:Tbc1d24 UTSW 17 24209069 unclassified probably benign
R6002:Tbc1d24 UTSW 17 24183787 start codon destroyed probably null 1.00
R6145:Tbc1d24 UTSW 17 24208229 missense probably damaging 1.00
R6245:Tbc1d24 UTSW 17 24185993 missense probably damaging 1.00
R6399:Tbc1d24 UTSW 17 24208329 missense probably damaging 0.97
R6764:Tbc1d24 UTSW 17 24185780 missense possibly damaging 0.95
R6893:Tbc1d24 UTSW 17 24182518 missense probably damaging 1.00
R7219:Tbc1d24 UTSW 17 24185292 missense probably damaging 1.00
R7262:Tbc1d24 UTSW 17 24207846 missense probably damaging 1.00
R7490:Tbc1d24 UTSW 17 24182520 missense probably damaging 1.00
R8014:Tbc1d24 UTSW 17 24182821 missense possibly damaging 0.64
R8558:Tbc1d24 UTSW 17 24208929 missense unknown
Z1176:Tbc1d24 UTSW 17 24206806 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTGGTGTAGCCTGCATTC -3'
(R):5'- TGAGGGGACTACACCGTGAATC -3'

Sequencing Primer
(F):5'- ATTCTTTGCTACCACTGAAGGC -3'
(R):5'- TTTGTCACACCAGGGCAG -3'
Posted On2020-01-23