Incidental Mutation 'R8013:Fbxo38'
ID617037
Institutional Source Beutler Lab
Gene Symbol Fbxo38
Ensembl Gene ENSMUSG00000042211
Gene NameF-box protein 38
Synonyms6030410I24Rik, SP329
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8013 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location62504069-62548743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62530811 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 203 (E203G)
Ref Sequence ENSEMBL: ENSMUSP00000047541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048688]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048688
AA Change: E203G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047541
Gene: ENSMUSG00000042211
AA Change: E203G

DomainStartEndE-ValueType
Pfam:F-box 29 66 2.6e-5 PFAM
SCOP:d1fqva2 127 357 6e-4 SMART
low complexity region 493 525 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 705 728 N/A INTRINSIC
low complexity region 736 753 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T G 6: 149,328,870 V1138G probably damaging Het
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Ahnak A G 19: 9,009,335 D2661G unknown Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Baz2a C T 10: 128,125,288 R1627C probably benign Het
Baz2a T G 10: 128,125,292 V1628G possibly damaging Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna1g T C 11: 94,456,970 Y764C probably damaging Het
Casr G A 16: 36,509,644 L443F probably benign Het
Cfap43 T A 19: 47,773,109 I849F probably damaging Het
Cntn3 A T 6: 102,199,317 H812Q probably benign Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Depdc5 C T 5: 32,973,842 T1229M probably benign Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Disp2 T A 2: 118,789,682 Y298* probably null Het
Dock2 A C 11: 34,705,850 I393S probably damaging Het
Dtd1 A G 2: 144,617,332 D92G probably damaging Het
Eef2 T A 10: 81,178,196 V121D probably damaging Het
Eml1 T A 12: 108,521,679 I550N probably benign Het
Entpd7 A G 19: 43,728,055 D496G probably benign Het
Ets2 T A 16: 95,716,100 L292Q probably damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Farp1 T A 14: 121,242,401 I368N probably damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fbn2 T C 18: 58,104,081 T617A possibly damaging Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Grsf1 A G 5: 88,675,756 probably null Het
Hephl1 T A 9: 15,054,609 D1016V possibly damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Krt78 T C 15: 101,948,542 R377G probably damaging Het
Lama2 T C 10: 27,344,498 H457R probably benign Het
Lmnb1 T A 18: 56,708,359 Y83N probably damaging Het
Loxl4 A G 19: 42,607,676 C113R probably damaging Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Map4k4 T C 1: 39,962,212 I53T unknown Het
Myo5b C T 18: 74,760,899 Q1700* probably null Het
Npas2 T C 1: 39,338,065 F503L probably benign Het
Nrg1 A T 8: 31,949,923 S149T probably benign Het
Olfr1243 A G 2: 89,527,936 V158A probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Olfr824 T A 10: 130,126,778 K93M probably damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Prss35 T C 9: 86,755,425 S83P probably damaging Het
Psme4 G A 11: 30,804,320 M192I probably benign Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Sar1b C T 11: 51,779,794 P55L possibly damaging Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Soga1 A G 2: 157,030,786 probably null Het
Stard9 T C 2: 120,688,101 I502T probably damaging Het
Sugp2 T A 8: 70,251,642 Y610N probably damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tpr G T 1: 150,398,608 V163L probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Wdr63 T C 3: 146,081,285 T332A probably damaging Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp536 T C 7: 37,569,610 N127S probably damaging Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Fbxo38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Fbxo38 APN 18 62530800 missense possibly damaging 0.59
IGL01384:Fbxo38 APN 18 62522416 missense probably damaging 0.98
IGL01443:Fbxo38 APN 18 62533670 missense probably damaging 1.00
IGL01515:Fbxo38 APN 18 62518571 missense probably benign 0.00
IGL01621:Fbxo38 APN 18 62522524 splice site probably benign
IGL01975:Fbxo38 APN 18 62515413 missense probably damaging 1.00
IGL02148:Fbxo38 APN 18 62536227 missense probably benign 0.02
IGL02390:Fbxo38 APN 18 62533589 missense probably damaging 1.00
IGL03040:Fbxo38 APN 18 62527252 missense probably damaging 1.00
IGL03088:Fbxo38 APN 18 62522472 missense possibly damaging 0.86
IGL03290:Fbxo38 APN 18 62526163 missense probably benign 0.08
FR4976:Fbxo38 UTSW 18 62515347 small deletion probably benign
R0526:Fbxo38 UTSW 18 62505980 missense probably damaging 1.00
R0529:Fbxo38 UTSW 18 62505986 missense probably damaging 1.00
R0789:Fbxo38 UTSW 18 62515499 missense possibly damaging 0.84
R1232:Fbxo38 UTSW 18 62510811 missense probably damaging 1.00
R1857:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1859:Fbxo38 UTSW 18 62515418 missense probably damaging 1.00
R1872:Fbxo38 UTSW 18 62517023 missense probably benign 0.01
R2114:Fbxo38 UTSW 18 62506640 missense possibly damaging 0.71
R2910:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R2911:Fbxo38 UTSW 18 62519807 missense probably benign 0.01
R3406:Fbxo38 UTSW 18 62514843 missense probably damaging 0.99
R3731:Fbxo38 UTSW 18 62515328 small deletion probably benign
R3792:Fbxo38 UTSW 18 62533462 splice site probably null
R3848:Fbxo38 UTSW 18 62515073 missense possibly damaging 0.87
R3948:Fbxo38 UTSW 18 62529544 splice site probably benign
R4151:Fbxo38 UTSW 18 62515328 small deletion probably benign
R4323:Fbxo38 UTSW 18 62515161 missense probably benign
R4456:Fbxo38 UTSW 18 62526249 missense probably damaging 1.00
R4786:Fbxo38 UTSW 18 62529674 missense probably damaging 1.00
R4829:Fbxo38 UTSW 18 62518591 missense probably benign
R4959:Fbxo38 UTSW 18 62522507 missense probably benign 0.45
R5274:Fbxo38 UTSW 18 62515069 missense probably damaging 0.98
R5288:Fbxo38 UTSW 18 62540971 missense probably benign
R5384:Fbxo38 UTSW 18 62540971 missense probably benign
R5385:Fbxo38 UTSW 18 62540971 missense probably benign
R5448:Fbxo38 UTSW 18 62522457 missense possibly damaging 0.59
R5540:Fbxo38 UTSW 18 62514793 critical splice donor site probably null
R5588:Fbxo38 UTSW 18 62526177 missense probably damaging 1.00
R5617:Fbxo38 UTSW 18 62505971 missense probably damaging 1.00
R5636:Fbxo38 UTSW 18 62511018 missense possibly damaging 0.80
R5769:Fbxo38 UTSW 18 62514965 missense probably benign 0.10
R6254:Fbxo38 UTSW 18 62505500 splice site probably null
R6315:Fbxo38 UTSW 18 62536147 nonsense probably null
R6517:Fbxo38 UTSW 18 62533563 missense probably damaging 1.00
R6673:Fbxo38 UTSW 18 62533915 missense probably damaging 1.00
R6974:Fbxo38 UTSW 18 62506669 missense possibly damaging 0.95
R7022:Fbxo38 UTSW 18 62536224 missense probably damaging 1.00
R7175:Fbxo38 UTSW 18 62515473 missense probably benign 0.11
R8815:Fbxo38 UTSW 18 62533516 missense probably damaging 1.00
Z1177:Fbxo38 UTSW 18 62515464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGATGACTATGACATTTTCCGAC -3'
(R):5'- AAGTCTTACAAGGTATGGCTATGAG -3'

Sequencing Primer
(F):5'- CCGACATTTGCCCATAACTGTATAGG -3'
(R):5'- GTCCCATTCTTTATAATGCAGTTTG -3'
Posted On2020-01-23