Incidental Mutation 'R8014:Olfr1228'
ID 617048
Institutional Source Beutler Lab
Gene Symbol Olfr1228
Ensembl Gene ENSMUSG00000099486
Gene Name olfactory receptor 1228
Synonyms MOR233-1, GA_x6K02T2Q125-50696209-50695274
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 89247964-89254062 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 89248999 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 220 (I220F)
Ref Sequence ENSEMBL: ENSMUSP00000150878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000190757] [ENSMUST00000215447] [ENSMUST00000216392]
AlphaFold Q8VGM9
Predicted Effect probably damaging
Transcript: ENSMUST00000190757
AA Change: I232F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139920
Gene: ENSMUSG00000099486
AA Change: I232F

DomainStartEndE-ValueType
Pfam:7tm_1 51 298 2.6e-27 PFAM
Pfam:7tm_4 150 292 2.9e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215447
AA Change: I220F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216392
AA Change: I220F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Aff1 A G 5: 103,833,869 T625A possibly damaging Het
Aldh8a1 T C 10: 21,389,302 V276A probably benign Het
Alkbh3 T C 2: 94,001,513 D124G probably benign Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Atp13a1 C T 8: 69,799,779 R608* probably null Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna2d1 A T 5: 16,342,691 T647S possibly damaging Het
Carmil1 T C 13: 24,036,321 E1140G possibly damaging Het
Ccdc158 C A 5: 92,649,030 E482D probably damaging Het
Ccdc92 A T 5: 124,836,026 H146Q probably damaging Het
Cntnap4 T A 8: 112,753,945 N341K probably damaging Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
D130043K22Rik A T 13: 24,856,702 I36F probably damaging Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gars T A 6: 55,073,407 F551Y probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm49333 A T 16: 20,642,317 T618S probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Gm9758 A G 5: 14,911,440 V175A possibly damaging Het
Gpr182 T C 10: 127,751,005 T26A possibly damaging Het
Gpr19 A G 6: 134,869,473 Y416H probably damaging Het
Itgb7 T A 15: 102,222,652 S322C probably damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Morc2a T C 11: 3,677,419 S281P probably damaging Het
Muc16 T C 9: 18,654,875 H2116R unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1264 C A 2: 90,021,743 V108F possibly damaging Het
Olfr1469 A T 19: 13,410,811 T81S not run Het
Olfr153 A T 2: 87,532,164 M44L probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Omg T C 11: 79,502,903 D43G possibly damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Pds5a A G 5: 65,627,739 I930T possibly damaging Het
Piezo2 C T 18: 63,083,200 G1169S probably benign Het
Pkhd1 A G 1: 20,508,891 probably null Het
Plekhg1 A T 10: 3,957,758 R947W Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Rin3 T A 12: 102,361,371 L193* probably null Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Stab2 C A 10: 86,850,903 S2259I possibly damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tmem108 A T 9: 103,499,407 I281N probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Usp44 G T 10: 93,852,709 probably null Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp599 A G 9: 22,249,481 Y463H probably benign Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Olfr1228
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01804:Olfr1228 APN 2 89249222 missense probably benign 0.00
IGL02588:Olfr1228 APN 2 89249698 splice site probably benign
R0384:Olfr1228 UTSW 2 89249070 missense possibly damaging 0.82
R0600:Olfr1228 UTSW 2 89249398 nonsense probably null
R0613:Olfr1228 UTSW 2 89249125 missense probably damaging 1.00
R1564:Olfr1228 UTSW 2 89249672 missense probably benign 0.00
R2115:Olfr1228 UTSW 2 89249530 missense probably damaging 1.00
R2313:Olfr1228 UTSW 2 89248941 missense probably damaging 1.00
R3083:Olfr1228 UTSW 2 89249001 missense probably damaging 0.96
R3790:Olfr1228 UTSW 2 89248993 missense probably benign 0.02
R3948:Olfr1228 UTSW 2 89248992 missense possibly damaging 0.95
R4373:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4376:Olfr1228 UTSW 2 89249245 missense possibly damaging 0.90
R4825:Olfr1228 UTSW 2 89248690 splice site probably null
R5022:Olfr1228 UTSW 2 89249417 missense probably benign 0.00
R5141:Olfr1228 UTSW 2 89249129 nonsense probably null
R5313:Olfr1228 UTSW 2 89249377 missense probably benign 0.05
R6010:Olfr1228 UTSW 2 89248743 missense probably benign 0.00
R7354:Olfr1228 UTSW 2 89248687 splice site probably null
R7548:Olfr1228 UTSW 2 89249086 missense probably benign 0.09
R8098:Olfr1228 UTSW 2 89249308 missense possibly damaging 0.95
R8280:Olfr1228 UTSW 2 89248890 missense probably damaging 0.98
R8554:Olfr1228 UTSW 2 89249251 missense possibly damaging 0.48
R8678:Olfr1228 UTSW 2 89249007 missense probably damaging 1.00
R8725:Olfr1228 UTSW 2 89249314 missense probably benign 0.00
R9039:Olfr1228 UTSW 2 89249201 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCATAGGATTCAGAAGTGGTG -3'
(R):5'- ATGACCAGGAGACTCTGTGG -3'

Sequencing Primer
(F):5'- CCATAGGATTCAGAAGTGGTGTTATG -3'
(R):5'- GGACAGGAGGATTCTTACATTCTCTC -3'
Posted On 2020-01-23