Incidental Mutation 'R8014:Fhdc1'
ID 617053
Institutional Source Beutler Lab
Gene Symbol Fhdc1
Ensembl Gene ENSMUSG00000041842
Gene Name FH2 domain containing 1
Synonyms 6330505N24Rik
MMRRC Submission 067454-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 84349505-84387736 bp(-) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to T at 84381946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000088525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091002] [ENSMUST00000107689] [ENSMUST00000194027]
AlphaFold Q3ULZ2
Predicted Effect probably null
Transcript: ENSMUST00000091002
AA Change: M1K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088525
Gene: ENSMUSG00000041842
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107689
AA Change: M1K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103317
Gene: ENSMUSG00000041842
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 30 48 N/A INTRINSIC
low complexity region 55 82 N/A INTRINSIC
FH2 88 538 5.13e-57 SMART
Blast:FH2 539 571 6e-6 BLAST
low complexity region 789 822 N/A INTRINSIC
low complexity region 962 976 N/A INTRINSIC
low complexity region 1009 1026 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194027
SMART Domains Protein: ENSMUSP00000142030
Gene: ENSMUSG00000041842

DomainStartEndE-ValueType
Pfam:FH2 1 145 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,615 (GRCm39) D7Y probably benign Het
Aff1 A G 5: 103,981,735 (GRCm39) T625A possibly damaging Het
Aldh8a1 T C 10: 21,265,201 (GRCm39) V276A probably benign Het
Alkbh3 T C 2: 93,831,858 (GRCm39) D124G probably benign Het
Apob T A 12: 8,060,798 (GRCm39) N3093K possibly damaging Het
Atp13a1 C T 8: 70,252,429 (GRCm39) R608* probably null Het
Bbs7 A T 3: 36,648,536 (GRCm39) I404K probably damaging Het
Cacna2d1 A T 5: 16,547,689 (GRCm39) T647S possibly damaging Het
Carmil1 T C 13: 24,220,304 (GRCm39) E1140G possibly damaging Het
Ccdc158 C A 5: 92,796,889 (GRCm39) E482D probably damaging Het
Ccdc92 A T 5: 124,913,090 (GRCm39) H146Q probably damaging Het
Cntnap4 T A 8: 113,480,577 (GRCm39) N341K probably damaging Het
Cog1 A G 11: 113,546,990 (GRCm39) D528G probably damaging Het
Cttnbp2 G C 6: 18,426,092 (GRCm39) A762G possibly damaging Het
D130043K22Rik A T 13: 25,040,685 (GRCm39) I36F probably damaging Het
Dis3 T A 14: 99,314,835 (GRCm39) R954W possibly damaging Het
Eef1ece2 A T 16: 20,461,067 (GRCm39) T618S probably benign Het
Ext1 T C 15: 52,939,283 (GRCm39) I589V possibly damaging Het
Fam20a T A 11: 109,576,332 (GRCm39) E142D possibly damaging Het
Fars2 C T 13: 36,389,068 (GRCm39) Q186* probably null Het
Fcgbpl1 G A 7: 27,836,966 (GRCm39) R295H probably benign Het
Gars1 T A 6: 55,050,392 (GRCm39) F551Y probably benign Het
Gm28363 A G 1: 117,654,534 (GRCm39) R58G probably benign Het
Gm8356 A T 14: 17,692,450 (GRCm39) N58K probably damaging Het
Gm9758 A G 5: 14,961,454 (GRCm39) V175A possibly damaging Het
Gpr182 T C 10: 127,586,874 (GRCm39) T26A possibly damaging Het
Gpr19 A G 6: 134,846,436 (GRCm39) Y416H probably damaging Het
Hrob A G 11: 102,148,725 (GRCm39) N379D probably benign Het
Itgb7 T A 15: 102,131,087 (GRCm39) S322C probably damaging Het
Kcnma1 T A 14: 23,423,211 (GRCm39) I831F probably benign Het
Lrba A T 3: 86,325,278 (GRCm39) D1912V probably damaging Het
Macf1 T A 4: 123,420,619 (GRCm39) T212S probably benign Het
Map3k4 A T 17: 12,489,918 (GRCm39) C504* probably null Het
Morc2a T C 11: 3,627,419 (GRCm39) S281P probably damaging Het
Muc16 T C 9: 18,566,171 (GRCm39) H2116R unknown Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Omg T C 11: 79,393,729 (GRCm39) D43G possibly damaging Het
Or13c7 T A 4: 43,854,958 (GRCm39) F216L probably benign Het
Or2ag15 C T 7: 106,340,824 (GRCm39) V106I probably benign Het
Or4c122 T A 2: 89,079,343 (GRCm39) I220F probably damaging Het
Or4c3 C A 2: 89,852,087 (GRCm39) V108F possibly damaging Het
Or5b3 A T 19: 13,388,175 (GRCm39) T81S not run Het
Or5w22 A T 2: 87,362,508 (GRCm39) M44L probably benign Het
Pdia6 T C 12: 17,323,966 (GRCm39) L66S probably damaging Het
Pds5a A G 5: 65,785,082 (GRCm39) I930T possibly damaging Het
Piezo2 C T 18: 63,216,271 (GRCm39) G1169S probably benign Het
Pkhd1 A G 1: 20,579,115 (GRCm39) probably null Het
Plekhg1 A T 10: 3,907,758 (GRCm39) R947W Het
Ptprs A C 17: 56,742,994 (GRCm39) S383A probably damaging Het
Rin3 T A 12: 102,327,630 (GRCm39) L193* probably null Het
Sgsh A G 11: 119,243,521 (GRCm39) V67A probably damaging Het
Slc16a4 A G 3: 107,218,794 (GRCm39) Y465C probably damaging Het
Stab2 C A 10: 86,686,767 (GRCm39) S2259I possibly damaging Het
Tbc1d24 G A 17: 24,401,795 (GRCm39) P385S possibly damaging Het
Tm4sf1 T C 3: 57,200,319 (GRCm39) I99V probably benign Het
Tmem108 A T 9: 103,376,606 (GRCm39) I281N probably benign Het
Usp31 T C 7: 121,248,480 (GRCm39) S988G probably damaging Het
Usp44 G T 10: 93,688,571 (GRCm39) probably null Het
Zbtb26 T A 2: 37,327,013 (GRCm39) probably null Het
Zfp599 A G 9: 22,160,777 (GRCm39) Y463H probably benign Het
Zfp750 T A 11: 121,403,843 (GRCm39) D344V possibly damaging Het
Zmym5 T A 14: 57,031,883 (GRCm39) K408N possibly damaging Het
Other mutations in Fhdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Fhdc1 APN 3 84,356,107 (GRCm39) missense probably damaging 1.00
IGL00556:Fhdc1 APN 3 84,364,549 (GRCm39) missense possibly damaging 0.81
IGL00951:Fhdc1 APN 3 84,371,620 (GRCm39) missense possibly damaging 0.90
IGL01744:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01754:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01762:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01764:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01769:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01778:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01779:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL01781:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02243:Fhdc1 APN 3 84,381,947 (GRCm39) start codon destroyed possibly damaging 0.89
IGL02260:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02261:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02266:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02271:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02284:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02292:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02296:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02301:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02347:Fhdc1 APN 3 84,352,042 (GRCm39) missense possibly damaging 0.66
IGL02416:Fhdc1 APN 3 84,352,535 (GRCm39) missense probably benign 0.03
IGL03189:Fhdc1 APN 3 84,362,368 (GRCm39) intron probably benign
IGL03392:Fhdc1 APN 3 84,351,826 (GRCm39) missense possibly damaging 0.55
R0125:Fhdc1 UTSW 3 84,352,852 (GRCm39) missense probably benign
R0135:Fhdc1 UTSW 3 84,352,925 (GRCm39) missense probably damaging 0.97
R0255:Fhdc1 UTSW 3 84,360,817 (GRCm39) intron probably benign
R0401:Fhdc1 UTSW 3 84,351,931 (GRCm39) missense probably benign 0.02
R1371:Fhdc1 UTSW 3 84,352,310 (GRCm39) missense probably damaging 1.00
R1727:Fhdc1 UTSW 3 84,353,483 (GRCm39) missense possibly damaging 0.50
R1769:Fhdc1 UTSW 3 84,356,085 (GRCm39) missense probably damaging 1.00
R1781:Fhdc1 UTSW 3 84,356,111 (GRCm39) missense probably damaging 0.99
R1840:Fhdc1 UTSW 3 84,353,128 (GRCm39) missense possibly damaging 0.46
R1970:Fhdc1 UTSW 3 84,362,158 (GRCm39) missense probably damaging 1.00
R2038:Fhdc1 UTSW 3 84,351,868 (GRCm39) missense probably benign 0.22
R2088:Fhdc1 UTSW 3 84,382,033 (GRCm39) start gained probably benign
R2256:Fhdc1 UTSW 3 84,353,353 (GRCm39) missense probably benign
R2939:Fhdc1 UTSW 3 84,364,577 (GRCm39) missense possibly damaging 0.47
R3813:Fhdc1 UTSW 3 84,371,577 (GRCm39) critical splice donor site probably null
R4022:Fhdc1 UTSW 3 84,352,409 (GRCm39) missense probably benign 0.01
R4175:Fhdc1 UTSW 3 84,364,294 (GRCm39) intron probably benign
R4243:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4245:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4290:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4291:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4292:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4293:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4294:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4295:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4334:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4335:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4342:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4344:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4354:Fhdc1 UTSW 3 84,352,133 (GRCm39) missense probably benign 0.42
R4550:Fhdc1 UTSW 3 84,352,483 (GRCm39) missense probably benign 0.16
R4626:Fhdc1 UTSW 3 84,381,557 (GRCm39) missense probably damaging 1.00
R4925:Fhdc1 UTSW 3 84,360,840 (GRCm39) missense probably damaging 1.00
R5155:Fhdc1 UTSW 3 84,353,457 (GRCm39) missense probably benign 0.00
R5588:Fhdc1 UTSW 3 84,372,783 (GRCm39) missense possibly damaging 0.91
R6043:Fhdc1 UTSW 3 84,356,193 (GRCm39) missense probably damaging 0.96
R6063:Fhdc1 UTSW 3 84,353,336 (GRCm39) missense probably benign 0.00
R6652:Fhdc1 UTSW 3 84,371,631 (GRCm39) missense probably damaging 1.00
R6706:Fhdc1 UTSW 3 84,353,729 (GRCm39) missense probably damaging 1.00
R6783:Fhdc1 UTSW 3 84,352,834 (GRCm39) missense probably benign 0.00
R6984:Fhdc1 UTSW 3 84,351,823 (GRCm39) missense possibly damaging 0.93
R7182:Fhdc1 UTSW 3 84,356,157 (GRCm39) missense probably damaging 0.98
R7299:Fhdc1 UTSW 3 84,351,847 (GRCm39) missense probably damaging 1.00
R7574:Fhdc1 UTSW 3 84,353,438 (GRCm39) missense probably benign
R7765:Fhdc1 UTSW 3 84,351,906 (GRCm39) missense probably benign 0.04
R8013:Fhdc1 UTSW 3 84,381,946 (GRCm39) start codon destroyed probably null 0.99
R8139:Fhdc1 UTSW 3 84,358,790 (GRCm39) missense probably damaging 1.00
R8264:Fhdc1 UTSW 3 84,362,339 (GRCm39) missense probably damaging 1.00
R8384:Fhdc1 UTSW 3 84,362,306 (GRCm39) missense possibly damaging 0.91
R8901:Fhdc1 UTSW 3 84,352,874 (GRCm39) missense probably benign
R9091:Fhdc1 UTSW 3 84,352,290 (GRCm39) missense unknown
R9270:Fhdc1 UTSW 3 84,352,290 (GRCm39) missense unknown
R9361:Fhdc1 UTSW 3 84,356,140 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGAGCTGTAGCCATTCAG -3'
(R):5'- GCACTGACTTTAAACTACTTGCTC -3'

Sequencing Primer
(F):5'- CTGTAGCCATTCAGGTAAGAAACTG -3'
(R):5'- TCCATCTTCGCAGGTCTGGAAG -3'
Posted On 2020-01-23