Incidental Mutation 'R8014:Lrba'
ID 617054
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene Name LPS-responsive beige-like anchor
Synonyms Lba, D3Ertd775e
MMRRC Submission 067454-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 86131987-86689999 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86325278 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1912 (D1912V)
Ref Sequence ENSEMBL: ENSMUSP00000103261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: D1912V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: D1912V

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192145
AA Change: D1912V

PolyPhen 2 Score 0.256 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: D1912V

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194759
AA Change: D1912V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: D1912V

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212390
AA Change: D1912V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,615 (GRCm39) D7Y probably benign Het
Aff1 A G 5: 103,981,735 (GRCm39) T625A possibly damaging Het
Aldh8a1 T C 10: 21,265,201 (GRCm39) V276A probably benign Het
Alkbh3 T C 2: 93,831,858 (GRCm39) D124G probably benign Het
Apob T A 12: 8,060,798 (GRCm39) N3093K possibly damaging Het
Atp13a1 C T 8: 70,252,429 (GRCm39) R608* probably null Het
Bbs7 A T 3: 36,648,536 (GRCm39) I404K probably damaging Het
Cacna2d1 A T 5: 16,547,689 (GRCm39) T647S possibly damaging Het
Carmil1 T C 13: 24,220,304 (GRCm39) E1140G possibly damaging Het
Ccdc158 C A 5: 92,796,889 (GRCm39) E482D probably damaging Het
Ccdc92 A T 5: 124,913,090 (GRCm39) H146Q probably damaging Het
Cntnap4 T A 8: 113,480,577 (GRCm39) N341K probably damaging Het
Cog1 A G 11: 113,546,990 (GRCm39) D528G probably damaging Het
Cttnbp2 G C 6: 18,426,092 (GRCm39) A762G possibly damaging Het
D130043K22Rik A T 13: 25,040,685 (GRCm39) I36F probably damaging Het
Dis3 T A 14: 99,314,835 (GRCm39) R954W possibly damaging Het
Eef1ece2 A T 16: 20,461,067 (GRCm39) T618S probably benign Het
Ext1 T C 15: 52,939,283 (GRCm39) I589V possibly damaging Het
Fam20a T A 11: 109,576,332 (GRCm39) E142D possibly damaging Het
Fars2 C T 13: 36,389,068 (GRCm39) Q186* probably null Het
Fcgbpl1 G A 7: 27,836,966 (GRCm39) R295H probably benign Het
Fhdc1 A T 3: 84,381,946 (GRCm39) M1K probably null Het
Gars1 T A 6: 55,050,392 (GRCm39) F551Y probably benign Het
Gm28363 A G 1: 117,654,534 (GRCm39) R58G probably benign Het
Gm8356 A T 14: 17,692,450 (GRCm39) N58K probably damaging Het
Gm9758 A G 5: 14,961,454 (GRCm39) V175A possibly damaging Het
Gpr182 T C 10: 127,586,874 (GRCm39) T26A possibly damaging Het
Gpr19 A G 6: 134,846,436 (GRCm39) Y416H probably damaging Het
Hrob A G 11: 102,148,725 (GRCm39) N379D probably benign Het
Itgb7 T A 15: 102,131,087 (GRCm39) S322C probably damaging Het
Kcnma1 T A 14: 23,423,211 (GRCm39) I831F probably benign Het
Macf1 T A 4: 123,420,619 (GRCm39) T212S probably benign Het
Map3k4 A T 17: 12,489,918 (GRCm39) C504* probably null Het
Morc2a T C 11: 3,627,419 (GRCm39) S281P probably damaging Het
Muc16 T C 9: 18,566,171 (GRCm39) H2116R unknown Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Omg T C 11: 79,393,729 (GRCm39) D43G possibly damaging Het
Or13c7 T A 4: 43,854,958 (GRCm39) F216L probably benign Het
Or2ag15 C T 7: 106,340,824 (GRCm39) V106I probably benign Het
Or4c122 T A 2: 89,079,343 (GRCm39) I220F probably damaging Het
Or4c3 C A 2: 89,852,087 (GRCm39) V108F possibly damaging Het
Or5b3 A T 19: 13,388,175 (GRCm39) T81S not run Het
Or5w22 A T 2: 87,362,508 (GRCm39) M44L probably benign Het
Pdia6 T C 12: 17,323,966 (GRCm39) L66S probably damaging Het
Pds5a A G 5: 65,785,082 (GRCm39) I930T possibly damaging Het
Piezo2 C T 18: 63,216,271 (GRCm39) G1169S probably benign Het
Pkhd1 A G 1: 20,579,115 (GRCm39) probably null Het
Plekhg1 A T 10: 3,907,758 (GRCm39) R947W Het
Ptprs A C 17: 56,742,994 (GRCm39) S383A probably damaging Het
Rin3 T A 12: 102,327,630 (GRCm39) L193* probably null Het
Sgsh A G 11: 119,243,521 (GRCm39) V67A probably damaging Het
Slc16a4 A G 3: 107,218,794 (GRCm39) Y465C probably damaging Het
Stab2 C A 10: 86,686,767 (GRCm39) S2259I possibly damaging Het
Tbc1d24 G A 17: 24,401,795 (GRCm39) P385S possibly damaging Het
Tm4sf1 T C 3: 57,200,319 (GRCm39) I99V probably benign Het
Tmem108 A T 9: 103,376,606 (GRCm39) I281N probably benign Het
Usp31 T C 7: 121,248,480 (GRCm39) S988G probably damaging Het
Usp44 G T 10: 93,688,571 (GRCm39) probably null Het
Zbtb26 T A 2: 37,327,013 (GRCm39) probably null Het
Zfp599 A G 9: 22,160,777 (GRCm39) Y463H probably benign Het
Zfp750 T A 11: 121,403,843 (GRCm39) D344V possibly damaging Het
Zmym5 T A 14: 57,031,883 (GRCm39) K408N possibly damaging Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86,267,089 (GRCm39) missense probably benign 0.00
IGL00788:Lrba APN 3 86,234,992 (GRCm39) missense probably damaging 0.97
IGL01139:Lrba APN 3 86,549,969 (GRCm39) missense possibly damaging 0.88
IGL01302:Lrba APN 3 86,202,707 (GRCm39) missense probably damaging 1.00
IGL01612:Lrba APN 3 86,683,484 (GRCm39) missense possibly damaging 0.89
IGL01718:Lrba APN 3 86,258,555 (GRCm39) missense probably damaging 1.00
IGL01719:Lrba APN 3 86,234,903 (GRCm39) splice site probably benign
IGL01730:Lrba APN 3 86,648,731 (GRCm39) missense possibly damaging 0.89
IGL01735:Lrba APN 3 86,234,968 (GRCm39) missense probably benign 0.28
IGL01875:Lrba APN 3 86,217,354 (GRCm39) missense probably damaging 1.00
IGL01884:Lrba APN 3 86,217,719 (GRCm39) missense possibly damaging 0.86
IGL02264:Lrba APN 3 86,687,569 (GRCm39) missense probably damaging 0.99
IGL02638:Lrba APN 3 86,232,380 (GRCm39) missense probably damaging 0.97
IGL02647:Lrba APN 3 86,267,038 (GRCm39) missense probably benign 0.00
IGL02664:Lrba APN 3 86,233,038 (GRCm39) missense possibly damaging 0.84
IGL02728:Lrba APN 3 86,683,356 (GRCm39) missense probably damaging 0.99
IGL02730:Lrba APN 3 86,235,506 (GRCm39) missense probably damaging 1.00
IGL02883:Lrba APN 3 86,352,720 (GRCm39) missense probably damaging 0.99
IGL02883:Lrba APN 3 86,261,513 (GRCm39) missense probably damaging 1.00
IGL02948:Lrba APN 3 86,217,691 (GRCm39) splice site probably null
IGL03090:Lrba APN 3 86,680,448 (GRCm39) missense probably benign 0.01
molasses UTSW 3 86,261,614 (GRCm39) critical splice donor site probably null
oscar UTSW 3 86,257,611 (GRCm39) nonsense probably null
oscar2 UTSW 3 86,571,765 (GRCm39) nonsense probably null
P0023:Lrba UTSW 3 86,325,242 (GRCm39) missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86,571,801 (GRCm39) nonsense probably null
R0077:Lrba UTSW 3 86,449,995 (GRCm39) missense probably damaging 0.99
R0189:Lrba UTSW 3 86,275,816 (GRCm39) missense probably damaging 1.00
R0217:Lrba UTSW 3 86,550,029 (GRCm39) missense probably damaging 1.00
R0349:Lrba UTSW 3 86,447,312 (GRCm39) missense probably damaging 1.00
R0396:Lrba UTSW 3 86,202,486 (GRCm39) missense probably damaging 1.00
R0417:Lrba UTSW 3 86,622,961 (GRCm39) missense probably damaging 1.00
R0536:Lrba UTSW 3 86,622,839 (GRCm39) missense probably damaging 1.00
R0712:Lrba UTSW 3 86,205,297 (GRCm39) nonsense probably null
R0722:Lrba UTSW 3 86,513,296 (GRCm39) critical splice donor site probably null
R0828:Lrba UTSW 3 86,515,677 (GRCm39) splice site probably null
R0927:Lrba UTSW 3 86,687,540 (GRCm39) missense probably damaging 1.00
R1120:Lrba UTSW 3 86,202,499 (GRCm39) missense probably damaging 1.00
R1141:Lrba UTSW 3 86,526,865 (GRCm39) missense probably damaging 1.00
R1276:Lrba UTSW 3 86,571,833 (GRCm39) missense probably damaging 1.00
R1449:Lrba UTSW 3 86,261,585 (GRCm39) missense probably damaging 1.00
R1470:Lrba UTSW 3 86,644,449 (GRCm39) missense probably damaging 1.00
R1470:Lrba UTSW 3 86,644,449 (GRCm39) missense probably damaging 1.00
R1474:Lrba UTSW 3 86,687,573 (GRCm39) splice site probably benign
R1558:Lrba UTSW 3 86,258,622 (GRCm39) missense probably damaging 1.00
R1596:Lrba UTSW 3 86,257,611 (GRCm39) nonsense probably null
R1652:Lrba UTSW 3 86,447,245 (GRCm39) missense probably damaging 1.00
R1800:Lrba UTSW 3 86,259,175 (GRCm39) missense probably benign 0.00
R1819:Lrba UTSW 3 86,449,941 (GRCm39) missense possibly damaging 0.80
R1862:Lrba UTSW 3 86,680,510 (GRCm39) critical splice donor site probably null
R1917:Lrba UTSW 3 86,571,808 (GRCm39) missense probably damaging 1.00
R1965:Lrba UTSW 3 86,513,175 (GRCm39) critical splice acceptor site probably null
R1966:Lrba UTSW 3 86,513,175 (GRCm39) critical splice acceptor site probably null
R1969:Lrba UTSW 3 86,515,696 (GRCm39) missense probably damaging 0.99
R2011:Lrba UTSW 3 86,217,324 (GRCm39) missense probably damaging 0.99
R2179:Lrba UTSW 3 86,261,588 (GRCm39) missense probably damaging 1.00
R2186:Lrba UTSW 3 86,211,643 (GRCm39) missense probably damaging 1.00
R2281:Lrba UTSW 3 86,683,410 (GRCm39) missense possibly damaging 0.46
R2359:Lrba UTSW 3 86,256,057 (GRCm39) missense probably benign 0.01
R2412:Lrba UTSW 3 86,235,007 (GRCm39) missense probably damaging 1.00
R2496:Lrba UTSW 3 86,439,394 (GRCm39) missense probably damaging 1.00
R3153:Lrba UTSW 3 86,192,526 (GRCm39) missense probably damaging 0.99
R3708:Lrba UTSW 3 86,192,331 (GRCm39) missense possibly damaging 0.80
R3746:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3747:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3748:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3749:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3750:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3758:Lrba UTSW 3 86,683,356 (GRCm39) missense probably damaging 0.99
R3975:Lrba UTSW 3 86,258,562 (GRCm39) missense probably damaging 1.00
R4210:Lrba UTSW 3 86,267,433 (GRCm39) missense probably damaging 1.00
R4258:Lrba UTSW 3 86,352,656 (GRCm39) missense probably damaging 1.00
R4657:Lrba UTSW 3 86,644,471 (GRCm39) missense probably damaging 1.00
R4713:Lrba UTSW 3 86,267,175 (GRCm39) missense probably benign 0.13
R4716:Lrba UTSW 3 86,550,021 (GRCm39) missense probably damaging 0.99
R4811:Lrba UTSW 3 86,683,448 (GRCm39) missense probably damaging 1.00
R4827:Lrba UTSW 3 86,267,457 (GRCm39) missense possibly damaging 0.85
R4840:Lrba UTSW 3 86,526,816 (GRCm39) critical splice acceptor site probably null
R4920:Lrba UTSW 3 86,571,765 (GRCm39) nonsense probably null
R4948:Lrba UTSW 3 86,192,335 (GRCm39) missense probably damaging 1.00
R4970:Lrba UTSW 3 86,132,678 (GRCm39) missense probably benign 0.23
R4985:Lrba UTSW 3 86,234,743 (GRCm39) splice site probably null
R4993:Lrba UTSW 3 86,267,344 (GRCm39) missense probably damaging 1.00
R5107:Lrba UTSW 3 86,267,086 (GRCm39) missense possibly damaging 0.47
R5112:Lrba UTSW 3 86,132,678 (GRCm39) missense probably benign 0.23
R5122:Lrba UTSW 3 86,256,461 (GRCm39) nonsense probably null
R5155:Lrba UTSW 3 86,258,607 (GRCm39) missense probably benign 0.25
R5194:Lrba UTSW 3 86,235,526 (GRCm39) missense probably damaging 1.00
R5280:Lrba UTSW 3 86,232,329 (GRCm39) missense possibly damaging 0.94
R5445:Lrba UTSW 3 86,275,902 (GRCm39) missense probably benign
R5469:Lrba UTSW 3 86,449,948 (GRCm39) missense probably damaging 1.00
R5513:Lrba UTSW 3 86,449,948 (GRCm39) missense probably damaging 1.00
R5578:Lrba UTSW 3 86,664,814 (GRCm39) missense probably benign 0.27
R5740:Lrba UTSW 3 86,235,649 (GRCm39) missense probably damaging 1.00
R5868:Lrba UTSW 3 86,226,911 (GRCm39) missense probably damaging 1.00
R6104:Lrba UTSW 3 86,261,099 (GRCm39) missense probably damaging 1.00
R6166:Lrba UTSW 3 86,261,614 (GRCm39) critical splice donor site probably null
R6279:Lrba UTSW 3 86,256,171 (GRCm39) missense probably benign 0.26
R6330:Lrba UTSW 3 86,255,664 (GRCm39) missense probably benign 0.07
R6367:Lrba UTSW 3 86,275,869 (GRCm39) missense probably benign 0.42
R6571:Lrba UTSW 3 86,267,367 (GRCm39) missense probably damaging 1.00
R6584:Lrba UTSW 3 86,571,883 (GRCm39) missense probably damaging 1.00
R6698:Lrba UTSW 3 86,211,732 (GRCm39) missense probably damaging 0.99
R6763:Lrba UTSW 3 86,261,570 (GRCm39) missense probably damaging 1.00
R6834:Lrba UTSW 3 86,257,593 (GRCm39) missense probably benign 0.00
R6951:Lrba UTSW 3 86,653,180 (GRCm39) missense probably benign 0.01
R6969:Lrba UTSW 3 86,526,897 (GRCm39) missense probably benign 0.21
R7045:Lrba UTSW 3 86,192,398 (GRCm39) missense probably benign 0.03
R7133:Lrba UTSW 3 86,302,238 (GRCm39) splice site probably null
R7182:Lrba UTSW 3 86,648,765 (GRCm39) frame shift probably null
R7214:Lrba UTSW 3 86,235,633 (GRCm39) missense probably damaging 1.00
R7224:Lrba UTSW 3 86,302,553 (GRCm39) missense probably damaging 1.00
R7243:Lrba UTSW 3 86,658,823 (GRCm39) splice site probably null
R7350:Lrba UTSW 3 86,259,209 (GRCm39) missense probably damaging 0.96
R7380:Lrba UTSW 3 86,232,381 (GRCm39) missense probably damaging 1.00
R7492:Lrba UTSW 3 86,571,835 (GRCm39) missense probably damaging 1.00
R7651:Lrba UTSW 3 86,648,773 (GRCm39) nonsense probably null
R7729:Lrba UTSW 3 86,225,474 (GRCm39) missense probably damaging 1.00
R7754:Lrba UTSW 3 86,352,704 (GRCm39) missense probably damaging 1.00
R7762:Lrba UTSW 3 86,439,508 (GRCm39) missense probably damaging 0.99
R7855:Lrba UTSW 3 86,222,737 (GRCm39) missense possibly damaging 0.94
R7867:Lrba UTSW 3 86,275,896 (GRCm39) missense probably damaging 1.00
R7912:Lrba UTSW 3 86,622,872 (GRCm39) missense probably damaging 1.00
R7995:Lrba UTSW 3 86,526,858 (GRCm39) missense probably damaging 1.00
R8013:Lrba UTSW 3 86,325,278 (GRCm39) missense probably damaging 1.00
R8024:Lrba UTSW 3 86,202,708 (GRCm39) nonsense probably null
R8027:Lrba UTSW 3 86,325,219 (GRCm39) missense probably benign 0.05
R8090:Lrba UTSW 3 86,255,796 (GRCm39) missense probably benign
R8111:Lrba UTSW 3 86,235,012 (GRCm39) missense probably damaging 1.00
R8118:Lrba UTSW 3 86,261,533 (GRCm39) missense probably benign
R8204:Lrba UTSW 3 86,222,710 (GRCm39) missense possibly damaging 0.95
R8239:Lrba UTSW 3 86,449,882 (GRCm39) missense probably damaging 1.00
R8509:Lrba UTSW 3 86,255,483 (GRCm39) missense probably benign 0.04
R8532:Lrba UTSW 3 86,664,790 (GRCm39) missense probably damaging 1.00
R8726:Lrba UTSW 3 86,261,062 (GRCm39) missense probably benign
R8744:Lrba UTSW 3 86,211,640 (GRCm39) missense probably benign 0.08
R8782:Lrba UTSW 3 86,549,976 (GRCm39) missense probably benign 0.00
R8784:Lrba UTSW 3 86,283,235 (GRCm39) missense probably damaging 1.00
R8922:Lrba UTSW 3 86,263,973 (GRCm39) missense probably damaging 1.00
R8964:Lrba UTSW 3 86,258,552 (GRCm39) missense probably benign 0.22
R8971:Lrba UTSW 3 86,522,388 (GRCm39) missense probably benign 0.00
R9046:Lrba UTSW 3 86,302,543 (GRCm39) missense possibly damaging 0.94
R9155:Lrba UTSW 3 86,202,508 (GRCm39) missense probably damaging 1.00
R9236:Lrba UTSW 3 86,261,066 (GRCm39) missense probably benign 0.05
R9266:Lrba UTSW 3 86,198,774 (GRCm39) missense probably benign 0.08
R9297:Lrba UTSW 3 86,280,873 (GRCm39) missense probably damaging 1.00
R9404:Lrba UTSW 3 86,205,224 (GRCm39) missense probably damaging 0.99
R9617:Lrba UTSW 3 86,267,169 (GRCm39) missense probably benign
R9640:Lrba UTSW 3 86,526,875 (GRCm39) nonsense probably null
R9779:Lrba UTSW 3 86,233,078 (GRCm39) missense probably damaging 1.00
X0065:Lrba UTSW 3 86,232,396 (GRCm39) missense possibly damaging 0.95
X0065:Lrba UTSW 3 86,205,206 (GRCm39) missense probably damaging 1.00
Z1176:Lrba UTSW 3 86,658,839 (GRCm39) missense possibly damaging 0.85
Z1176:Lrba UTSW 3 86,622,845 (GRCm39) missense probably benign 0.31
Z1177:Lrba UTSW 3 86,447,356 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGGGAGTACATATTCCTTCC -3'
(R):5'- AGGGTGAACTAGTGCTGAACC -3'

Sequencing Primer
(F):5'- AAGGGAGTACATATTCCTTCCTCTTC -3'
(R):5'- TGCTGAACCAGGACAGCTTTC -3'
Posted On 2020-01-23