Incidental Mutation 'R8014:Slc16a4'
ID617055
Institutional Source Beutler Lab
Gene Symbol Slc16a4
Ensembl Gene ENSMUSG00000027896
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8014 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107291230-107312115 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107311478 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 465 (Y465C)
Ref Sequence ENSEMBL: ENSMUSP00000029502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029502] [ENSMUST00000106723]
Predicted Effect probably damaging
Transcript: ENSMUST00000029502
AA Change: Y465C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029502
Gene: ENSMUSG00000027896
AA Change: Y465C

DomainStartEndE-ValueType
Pfam:MFS_1 27 373 8.2e-26 PFAM
Pfam:MFS_1 305 499 2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106723
SMART Domains Protein: ENSMUSP00000102334
Gene: ENSMUSG00000027896

DomainStartEndE-ValueType
Pfam:MFS_1 27 375 2.1e-28 PFAM
Pfam:MFS_1 327 462 3.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Aff1 A G 5: 103,833,869 T625A possibly damaging Het
Aldh8a1 T C 10: 21,389,302 V276A probably benign Het
Alkbh3 T C 2: 94,001,513 D124G probably benign Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Atp13a1 C T 8: 69,799,779 R608* probably null Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna2d1 A T 5: 16,342,691 T647S possibly damaging Het
Carmil1 T C 13: 24,036,321 E1140G possibly damaging Het
Ccdc158 C A 5: 92,649,030 E482D probably damaging Het
Ccdc92 A T 5: 124,836,026 H146Q probably damaging Het
Cntnap4 T A 8: 112,753,945 N341K probably damaging Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
D130043K22Rik A T 13: 24,856,702 I36F probably damaging Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gars T A 6: 55,073,407 F551Y probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm49333 A T 16: 20,642,317 T618S probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Gm9758 A G 5: 14,911,440 V175A possibly damaging Het
Gpr182 T C 10: 127,751,005 T26A possibly damaging Het
Gpr19 A G 6: 134,869,473 Y416H probably damaging Het
Itgb7 T A 15: 102,222,652 S322C probably damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Morc2a T C 11: 3,677,419 S281P probably damaging Het
Muc16 T C 9: 18,654,875 H2116R unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1228 T A 2: 89,248,999 I220F probably damaging Het
Olfr1264 C A 2: 90,021,743 V108F possibly damaging Het
Olfr1469 A T 19: 13,410,811 T81S not run Het
Olfr153 A T 2: 87,532,164 M44L probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Omg T C 11: 79,502,903 D43G possibly damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Pds5a A G 5: 65,627,739 I930T possibly damaging Het
Piezo2 C T 18: 63,083,200 G1169S probably benign Het
Pkhd1 A G 1: 20,508,891 probably null Het
Plekhg1 A T 10: 3,957,758 R947W Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Rin3 T A 12: 102,361,371 L193* probably null Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Stab2 C A 10: 86,850,903 S2259I possibly damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tmem108 A T 9: 103,499,407 I281N probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Usp44 G T 10: 93,852,709 probably null Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp599 A G 9: 22,249,481 Y463H probably benign Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Slc16a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc16a4 APN 3 107303100 missense possibly damaging 0.67
IGL01311:Slc16a4 APN 3 107292505 missense possibly damaging 0.83
IGL01509:Slc16a4 APN 3 107311434 critical splice acceptor site probably null
IGL01780:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02294:Slc16a4 APN 3 107301068 missense probably benign 0.00
IGL02350:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02357:Slc16a4 APN 3 107303099 missense probably benign 0.00
IGL02792:Slc16a4 APN 3 107298877 missense probably benign
IGL02873:Slc16a4 APN 3 107300795 missense probably benign 0.00
IGL03001:Slc16a4 APN 3 107311542 missense possibly damaging 0.91
IGL03002:Slc16a4 APN 3 107300786 missense probably benign 0.07
R0370:Slc16a4 UTSW 3 107301097 missense possibly damaging 0.66
R0525:Slc16a4 UTSW 3 107297939 splice site probably benign
R1192:Slc16a4 UTSW 3 107298873 missense probably benign 0.07
R1458:Slc16a4 UTSW 3 107300932 missense probably benign 0.00
R1939:Slc16a4 UTSW 3 107301001 missense probably benign 0.00
R2061:Slc16a4 UTSW 3 107300711 missense probably benign 0.00
R2098:Slc16a4 UTSW 3 107300847 nonsense probably null
R2102:Slc16a4 UTSW 3 107304503 splice site probably null
R3411:Slc16a4 UTSW 3 107300872 missense probably benign
R4983:Slc16a4 UTSW 3 107300860 missense probably benign 0.00
R5394:Slc16a4 UTSW 3 107292442 missense probably benign
R5804:Slc16a4 UTSW 3 107298964 missense probably benign 0.04
R6077:Slc16a4 UTSW 3 107301065 missense possibly damaging 0.91
R6626:Slc16a4 UTSW 3 107301196 missense possibly damaging 0.95
R6693:Slc16a4 UTSW 3 107303064 missense probably damaging 1.00
R6811:Slc16a4 UTSW 3 107298917 missense probably benign 0.06
R6823:Slc16a4 UTSW 3 107311498 missense probably benign 0.02
R6982:Slc16a4 UTSW 3 107299273 missense probably benign 0.01
R7050:Slc16a4 UTSW 3 107300832 missense probably benign
R7103:Slc16a4 UTSW 3 107311471 missense probably damaging 1.00
R7608:Slc16a4 UTSW 3 107303127 missense probably damaging 1.00
R7623:Slc16a4 UTSW 3 107297981 missense possibly damaging 0.71
R8013:Slc16a4 UTSW 3 107311478 missense probably damaging 1.00
X0018:Slc16a4 UTSW 3 107300815 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTATTTAAGTCCAATGGCTCAC -3'
(R):5'- TCCTGGCAGTGCTAAGAAAG -3'

Sequencing Primer
(F):5'- GTCCAATGGCTCACAATATGGACTG -3'
(R):5'- TGGCTTGCTTTCTTAACAAAGAC -3'
Posted On2020-01-23