Incidental Mutation 'R8014:Tmem108'
ID 617074
Institutional Source Beutler Lab
Gene Symbol Tmem108
Ensembl Gene ENSMUSG00000042757
Gene Name transmembrane protein 108
Synonyms B130017P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 103482947-103761837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103499407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 281 (I281N)
Ref Sequence ENSEMBL: ENSMUSP00000046021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000189066] [ENSMUST00000189588]
AlphaFold Q8BHE4
Predicted Effect probably benign
Transcript: ENSMUST00000049452
AA Change: I281N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757
AA Change: I281N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189066
AA Change: I281N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757
AA Change: I281N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189588
AA Change: I281N

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757
AA Change: I281N

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with drastically reduced expression exhibit decreased excitatory postsynaptic currents of dentate gyrate granule neurons, impaired sensorimotor gating, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Aff1 A G 5: 103,833,869 T625A possibly damaging Het
Aldh8a1 T C 10: 21,389,302 V276A probably benign Het
Alkbh3 T C 2: 94,001,513 D124G probably benign Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Atp13a1 C T 8: 69,799,779 R608* probably null Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna2d1 A T 5: 16,342,691 T647S possibly damaging Het
Carmil1 T C 13: 24,036,321 E1140G possibly damaging Het
Ccdc158 C A 5: 92,649,030 E482D probably damaging Het
Ccdc92 A T 5: 124,836,026 H146Q probably damaging Het
Cntnap4 T A 8: 112,753,945 N341K probably damaging Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
D130043K22Rik A T 13: 24,856,702 I36F probably damaging Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gars T A 6: 55,073,407 F551Y probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm49333 A T 16: 20,642,317 T618S probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Gm9758 A G 5: 14,911,440 V175A possibly damaging Het
Gpr182 T C 10: 127,751,005 T26A possibly damaging Het
Gpr19 A G 6: 134,869,473 Y416H probably damaging Het
Itgb7 T A 15: 102,222,652 S322C probably damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Morc2a T C 11: 3,677,419 S281P probably damaging Het
Muc16 T C 9: 18,654,875 H2116R unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1228 T A 2: 89,248,999 I220F probably damaging Het
Olfr1264 C A 2: 90,021,743 V108F possibly damaging Het
Olfr1469 A T 19: 13,410,811 T81S not run Het
Olfr153 A T 2: 87,532,164 M44L probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Omg T C 11: 79,502,903 D43G possibly damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Pds5a A G 5: 65,627,739 I930T possibly damaging Het
Piezo2 C T 18: 63,083,200 G1169S probably benign Het
Pkhd1 A G 1: 20,508,891 probably null Het
Plekhg1 A T 10: 3,957,758 R947W Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Rin3 T A 12: 102,361,371 L193* probably null Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Stab2 C A 10: 86,850,903 S2259I possibly damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Usp44 G T 10: 93,852,709 probably null Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp599 A G 9: 22,249,481 Y463H probably benign Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Tmem108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Tmem108 APN 9 103484751 missense probably benign 0.04
IGL02008:Tmem108 APN 9 103489240 missense possibly damaging 0.85
IGL02318:Tmem108 APN 9 103499782 missense probably benign 0.14
R0019:Tmem108 UTSW 9 103489340 missense possibly damaging 0.93
R0092:Tmem108 UTSW 9 103489305 missense possibly damaging 0.71
R0378:Tmem108 UTSW 9 103499657 missense possibly damaging 0.71
R0781:Tmem108 UTSW 9 103484690 missense probably damaging 0.98
R1138:Tmem108 UTSW 9 103498969 missense possibly damaging 0.71
R2090:Tmem108 UTSW 9 103484777 missense possibly damaging 0.57
R2137:Tmem108 UTSW 9 103499963 missense possibly damaging 0.71
R2520:Tmem108 UTSW 9 103489282 missense possibly damaging 0.85
R4724:Tmem108 UTSW 9 103499489 missense possibly damaging 0.86
R4883:Tmem108 UTSW 9 103499077 missense possibly damaging 0.93
R5358:Tmem108 UTSW 9 103499518 missense probably damaging 0.98
R6337:Tmem108 UTSW 9 103499761 missense possibly damaging 0.95
R6888:Tmem108 UTSW 9 103499716 missense probably damaging 1.00
R7223:Tmem108 UTSW 9 103499534 missense not run
R8139:Tmem108 UTSW 9 103499885 missense probably benign 0.02
R8355:Tmem108 UTSW 9 103499870 missense possibly damaging 0.86
R8455:Tmem108 UTSW 9 103499870 missense possibly damaging 0.86
R8937:Tmem108 UTSW 9 103484782 missense probably benign 0.15
R8940:Tmem108 UTSW 9 103499957 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GTGTGACAGCAAGCCAAGAGTC -3'
(R):5'- ACCAGAGCTCAGCACATCTG -3'

Sequencing Primer
(F):5'- CAAGCCAAGAGTCACTGTGGC -3'
(R):5'- ATCTACAAGGGTAACTTTACGGGGTC -3'
Posted On 2020-01-23