Incidental Mutation 'R8014:Usp44'
ID 617078
Institutional Source Beutler Lab
Gene Symbol Usp44
Ensembl Gene ENSMUSG00000020020
Gene Name ubiquitin specific peptidase 44
Synonyms E430004F17Rik
MMRRC Submission 067454-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 93667417-93693950 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) G to T at 93688571 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095333] [ENSMUST00000216224] [ENSMUST00000216224]
AlphaFold Q8C2S0
Predicted Effect probably benign
Transcript: ENSMUST00000095333
SMART Domains Protein: ENSMUSP00000092975
Gene: ENSMUSG00000020020

DomainStartEndE-ValueType
Pfam:zf-UBP 26 88 5.4e-23 PFAM
Pfam:UCH 161 480 3.1e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216224
Predicted Effect probably null
Transcript: ENSMUST00000216224
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease that functions as a deubiquitinating enzyme. The encoded protein is thought to help regulate the spindle assembly checkpoint by preventing early anaphase onset. This protein specifically deubiquitinates CDC20, which stabilizes the anaphase promoting complex/cyclosome. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit chromosomal instability, aneuploidy and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,615 (GRCm39) D7Y probably benign Het
Aff1 A G 5: 103,981,735 (GRCm39) T625A possibly damaging Het
Aldh8a1 T C 10: 21,265,201 (GRCm39) V276A probably benign Het
Alkbh3 T C 2: 93,831,858 (GRCm39) D124G probably benign Het
Apob T A 12: 8,060,798 (GRCm39) N3093K possibly damaging Het
Atp13a1 C T 8: 70,252,429 (GRCm39) R608* probably null Het
Bbs7 A T 3: 36,648,536 (GRCm39) I404K probably damaging Het
Cacna2d1 A T 5: 16,547,689 (GRCm39) T647S possibly damaging Het
Carmil1 T C 13: 24,220,304 (GRCm39) E1140G possibly damaging Het
Ccdc158 C A 5: 92,796,889 (GRCm39) E482D probably damaging Het
Ccdc92 A T 5: 124,913,090 (GRCm39) H146Q probably damaging Het
Cntnap4 T A 8: 113,480,577 (GRCm39) N341K probably damaging Het
Cog1 A G 11: 113,546,990 (GRCm39) D528G probably damaging Het
Cttnbp2 G C 6: 18,426,092 (GRCm39) A762G possibly damaging Het
D130043K22Rik A T 13: 25,040,685 (GRCm39) I36F probably damaging Het
Dis3 T A 14: 99,314,835 (GRCm39) R954W possibly damaging Het
Eef1ece2 A T 16: 20,461,067 (GRCm39) T618S probably benign Het
Ext1 T C 15: 52,939,283 (GRCm39) I589V possibly damaging Het
Fam20a T A 11: 109,576,332 (GRCm39) E142D possibly damaging Het
Fars2 C T 13: 36,389,068 (GRCm39) Q186* probably null Het
Fcgbpl1 G A 7: 27,836,966 (GRCm39) R295H probably benign Het
Fhdc1 A T 3: 84,381,946 (GRCm39) M1K probably null Het
Gars1 T A 6: 55,050,392 (GRCm39) F551Y probably benign Het
Gm28363 A G 1: 117,654,534 (GRCm39) R58G probably benign Het
Gm8356 A T 14: 17,692,450 (GRCm39) N58K probably damaging Het
Gm9758 A G 5: 14,961,454 (GRCm39) V175A possibly damaging Het
Gpr182 T C 10: 127,586,874 (GRCm39) T26A possibly damaging Het
Gpr19 A G 6: 134,846,436 (GRCm39) Y416H probably damaging Het
Hrob A G 11: 102,148,725 (GRCm39) N379D probably benign Het
Itgb7 T A 15: 102,131,087 (GRCm39) S322C probably damaging Het
Kcnma1 T A 14: 23,423,211 (GRCm39) I831F probably benign Het
Lrba A T 3: 86,325,278 (GRCm39) D1912V probably damaging Het
Macf1 T A 4: 123,420,619 (GRCm39) T212S probably benign Het
Map3k4 A T 17: 12,489,918 (GRCm39) C504* probably null Het
Morc2a T C 11: 3,627,419 (GRCm39) S281P probably damaging Het
Muc16 T C 9: 18,566,171 (GRCm39) H2116R unknown Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Omg T C 11: 79,393,729 (GRCm39) D43G possibly damaging Het
Or13c7 T A 4: 43,854,958 (GRCm39) F216L probably benign Het
Or2ag15 C T 7: 106,340,824 (GRCm39) V106I probably benign Het
Or4c122 T A 2: 89,079,343 (GRCm39) I220F probably damaging Het
Or4c3 C A 2: 89,852,087 (GRCm39) V108F possibly damaging Het
Or5b3 A T 19: 13,388,175 (GRCm39) T81S not run Het
Or5w22 A T 2: 87,362,508 (GRCm39) M44L probably benign Het
Pdia6 T C 12: 17,323,966 (GRCm39) L66S probably damaging Het
Pds5a A G 5: 65,785,082 (GRCm39) I930T possibly damaging Het
Piezo2 C T 18: 63,216,271 (GRCm39) G1169S probably benign Het
Pkhd1 A G 1: 20,579,115 (GRCm39) probably null Het
Plekhg1 A T 10: 3,907,758 (GRCm39) R947W Het
Ptprs A C 17: 56,742,994 (GRCm39) S383A probably damaging Het
Rin3 T A 12: 102,327,630 (GRCm39) L193* probably null Het
Sgsh A G 11: 119,243,521 (GRCm39) V67A probably damaging Het
Slc16a4 A G 3: 107,218,794 (GRCm39) Y465C probably damaging Het
Stab2 C A 10: 86,686,767 (GRCm39) S2259I possibly damaging Het
Tbc1d24 G A 17: 24,401,795 (GRCm39) P385S possibly damaging Het
Tm4sf1 T C 3: 57,200,319 (GRCm39) I99V probably benign Het
Tmem108 A T 9: 103,376,606 (GRCm39) I281N probably benign Het
Usp31 T C 7: 121,248,480 (GRCm39) S988G probably damaging Het
Zbtb26 T A 2: 37,327,013 (GRCm39) probably null Het
Zfp599 A G 9: 22,160,777 (GRCm39) Y463H probably benign Het
Zfp750 T A 11: 121,403,843 (GRCm39) D344V possibly damaging Het
Zmym5 T A 14: 57,031,883 (GRCm39) K408N possibly damaging Het
Other mutations in Usp44
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Usp44 UTSW 10 93,681,517 (GRCm39) start gained probably benign
R0497:Usp44 UTSW 10 93,682,668 (GRCm39) missense possibly damaging 0.77
R0789:Usp44 UTSW 10 93,683,082 (GRCm39) intron probably benign
R1521:Usp44 UTSW 10 93,683,048 (GRCm39) nonsense probably null
R4032:Usp44 UTSW 10 93,683,127 (GRCm39) intron probably benign
R4212:Usp44 UTSW 10 93,682,632 (GRCm39) missense possibly damaging 0.55
R4755:Usp44 UTSW 10 93,682,768 (GRCm39) missense probably damaging 1.00
R4764:Usp44 UTSW 10 93,681,933 (GRCm39) missense probably benign 0.17
R5095:Usp44 UTSW 10 93,682,707 (GRCm39) missense possibly damaging 0.70
R5775:Usp44 UTSW 10 93,681,840 (GRCm39) missense possibly damaging 0.80
R6029:Usp44 UTSW 10 93,682,494 (GRCm39) missense probably damaging 0.96
R6193:Usp44 UTSW 10 93,683,010 (GRCm39) intron probably benign
R6233:Usp44 UTSW 10 93,686,202 (GRCm39) missense probably damaging 1.00
R6338:Usp44 UTSW 10 93,682,375 (GRCm39) missense probably damaging 1.00
R6374:Usp44 UTSW 10 93,692,172 (GRCm39) missense probably benign 0.12
R6556:Usp44 UTSW 10 93,681,870 (GRCm39) missense probably benign 0.20
R6615:Usp44 UTSW 10 93,682,351 (GRCm39) missense possibly damaging 0.48
R7099:Usp44 UTSW 10 93,686,049 (GRCm39) missense possibly damaging 0.95
R7224:Usp44 UTSW 10 93,681,855 (GRCm39) missense probably benign 0.08
R7361:Usp44 UTSW 10 93,682,330 (GRCm39) missense probably benign 0.00
R7576:Usp44 UTSW 10 93,682,290 (GRCm39) missense probably damaging 0.99
R8695:Usp44 UTSW 10 93,682,365 (GRCm39) missense probably damaging 1.00
R8919:Usp44 UTSW 10 93,693,775 (GRCm39) missense probably benign 0.00
R8950:Usp44 UTSW 10 93,682,129 (GRCm39) missense possibly damaging 0.93
R9144:Usp44 UTSW 10 93,681,645 (GRCm39) missense probably benign 0.09
R9254:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9379:Usp44 UTSW 10 93,688,635 (GRCm39) missense possibly damaging 0.93
R9488:Usp44 UTSW 10 93,682,851 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGGTGTCACCTCCATCATG -3'
(R):5'- TCTAAGTCTTGAAGCATCCTTACC -3'

Sequencing Primer
(F):5'- TCCATCATGGTGCTAGACCTGG -3'
(R):5'- GTCTTGAAGCATCCTTACCAGAAG -3'
Posted On 2020-01-23