Incidental Mutation 'R8014:D130043K22Rik'
ID 617091
Institutional Source Beutler Lab
Gene Symbol D130043K22Rik
Ensembl Gene ENSMUSG00000006711
Gene Name RIKEN cDNA D130043K22 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 24845135-24901270 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24856702 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 36 (I36F)
Ref Sequence ENSEMBL: ENSMUSP00000006893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006893] [ENSMUST00000141572]
AlphaFold Q5SZV5
Predicted Effect probably damaging
Transcript: ENSMUST00000006893
AA Change: I36F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006893
Gene: ENSMUSG00000006711
AA Change: I36F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 3e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
FN3 728 808 9.15e1 SMART
PKD 729 820 4.38e-10 SMART
transmembrane domain 965 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141572
AA Change: I36F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116004
Gene: ENSMUSG00000006711
AA Change: I36F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:MANEC 23 102 2e-44 BLAST
low complexity region 236 270 N/A INTRINSIC
FN3 332 427 3.43e1 SMART
PKD 345 436 3.96e0 SMART
FN3 435 521 3.08e1 SMART
PKD 444 533 7.12e-10 SMART
PKD 539 629 1.46e-6 SMART
PKD 630 723 6.75e-11 SMART
FN3 634 711 5.1e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that contains a large extracellular domain with multiple polycystic kidney disease (PKD) domains. The encoded protein may play a role in the development of the cerebral cortex by regulating neuronal migration and cell adhesion. Single nucleotide polymorphisms in a similar gene in human are associated with dyslexia. Alternatively spliced transcript variants have been identifed. [provided by RefSeq, May 2015]
PHENOTYPE: Homozygous knockout results in a mild behavioral phenotype: increased prepulse inhibition in males under certain conditions and decreased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Aff1 A G 5: 103,833,869 T625A possibly damaging Het
Aldh8a1 T C 10: 21,389,302 V276A probably benign Het
Alkbh3 T C 2: 94,001,513 D124G probably benign Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Atp13a1 C T 8: 69,799,779 R608* probably null Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna2d1 A T 5: 16,342,691 T647S possibly damaging Het
Carmil1 T C 13: 24,036,321 E1140G possibly damaging Het
Ccdc158 C A 5: 92,649,030 E482D probably damaging Het
Ccdc92 A T 5: 124,836,026 H146Q probably damaging Het
Cntnap4 T A 8: 112,753,945 N341K probably damaging Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Ext1 T C 15: 53,075,887 I589V possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gars T A 6: 55,073,407 F551Y probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm49333 A T 16: 20,642,317 T618S probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Gm9758 A G 5: 14,911,440 V175A possibly damaging Het
Gpr182 T C 10: 127,751,005 T26A possibly damaging Het
Gpr19 A G 6: 134,869,473 Y416H probably damaging Het
Itgb7 T A 15: 102,222,652 S322C probably damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Morc2a T C 11: 3,677,419 S281P probably damaging Het
Muc16 T C 9: 18,654,875 H2116R unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1228 T A 2: 89,248,999 I220F probably damaging Het
Olfr1264 C A 2: 90,021,743 V108F possibly damaging Het
Olfr1469 A T 19: 13,410,811 T81S not run Het
Olfr153 A T 2: 87,532,164 M44L probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Omg T C 11: 79,502,903 D43G possibly damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Pds5a A G 5: 65,627,739 I930T possibly damaging Het
Piezo2 C T 18: 63,083,200 G1169S probably benign Het
Pkhd1 A G 1: 20,508,891 probably null Het
Plekhg1 A T 10: 3,957,758 R947W Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Rin3 T A 12: 102,361,371 L193* probably null Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Stab2 C A 10: 86,850,903 S2259I possibly damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tmem108 A T 9: 103,499,407 I281N probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Usp44 G T 10: 93,852,709 probably null Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp599 A G 9: 22,249,481 Y463H probably benign Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in D130043K22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:D130043K22Rik APN 13 24867174 missense probably damaging 1.00
IGL01114:D130043K22Rik APN 13 24857156 missense probably damaging 0.99
IGL01412:D130043K22Rik APN 13 24887860 missense probably damaging 1.00
IGL01542:D130043K22Rik APN 13 24876037 splice site probably null
IGL01615:D130043K22Rik APN 13 24899796 missense probably damaging 1.00
IGL01705:D130043K22Rik APN 13 24857941 missense probably benign 0.00
IGL02220:D130043K22Rik APN 13 24883755 missense possibly damaging 0.95
IGL02229:D130043K22Rik APN 13 24875924 missense probably damaging 1.00
IGL02576:D130043K22Rik APN 13 24856870 missense possibly damaging 0.74
IGL03038:D130043K22Rik APN 13 24879619 missense probably damaging 1.00
IGL03117:D130043K22Rik APN 13 24889842 missense probably damaging 1.00
IGL03014:D130043K22Rik UTSW 13 24858092 missense possibly damaging 0.88
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0019:D130043K22Rik UTSW 13 24880812 missense probably damaging 1.00
R0020:D130043K22Rik UTSW 13 24854492 utr 5 prime probably benign
R0172:D130043K22Rik UTSW 13 24872406 missense probably benign 0.16
R0276:D130043K22Rik UTSW 13 24858045 missense possibly damaging 0.92
R0304:D130043K22Rik UTSW 13 24864815 missense probably benign 0.07
R0335:D130043K22Rik UTSW 13 24887877 missense probably damaging 0.98
R0744:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0833:D130043K22Rik UTSW 13 24863580 splice site probably benign
R0836:D130043K22Rik UTSW 13 24863580 splice site probably benign
R1270:D130043K22Rik UTSW 13 24857338 missense probably benign 0.00
R1433:D130043K22Rik UTSW 13 24871341 missense probably damaging 1.00
R1682:D130043K22Rik UTSW 13 24882556 missense probably damaging 1.00
R1772:D130043K22Rik UTSW 13 24875999 missense probably damaging 1.00
R1773:D130043K22Rik UTSW 13 24882602 missense possibly damaging 0.80
R1800:D130043K22Rik UTSW 13 24883894 missense probably damaging 1.00
R1956:D130043K22Rik UTSW 13 24885595 missense probably damaging 1.00
R2255:D130043K22Rik UTSW 13 24856911 missense probably damaging 1.00
R2445:D130043K22Rik UTSW 13 24857036 missense probably benign 0.04
R2568:D130043K22Rik UTSW 13 24883891 missense probably damaging 0.97
R4160:D130043K22Rik UTSW 13 24862696 missense probably benign 0.02
R4494:D130043K22Rik UTSW 13 24871356 missense probably benign 0.16
R4732:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4733:D130043K22Rik UTSW 13 24899665 missense probably damaging 1.00
R4782:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4799:D130043K22Rik UTSW 13 24878040 missense probably damaging 1.00
R4864:D130043K22Rik UTSW 13 24863612 missense probably damaging 1.00
R5155:D130043K22Rik UTSW 13 24872290 missense probably damaging 1.00
R5240:D130043K22Rik UTSW 13 24877977 missense probably damaging 1.00
R5383:D130043K22Rik UTSW 13 24857414 missense probably benign 0.02
R5493:D130043K22Rik UTSW 13 24863603 missense probably damaging 1.00
R6184:D130043K22Rik UTSW 13 24885591 missense probably damaging 1.00
R6305:D130043K22Rik UTSW 13 24885685 missense probably damaging 1.00
R6436:D130043K22Rik UTSW 13 24877935 missense probably damaging 1.00
R6980:D130043K22Rik UTSW 13 24864781 missense probably damaging 0.98
R7038:D130043K22Rik UTSW 13 24893408 missense probably damaging 1.00
R7085:D130043K22Rik UTSW 13 24872302 missense possibly damaging 0.95
R7147:D130043K22Rik UTSW 13 24882563 missense probably benign 0.31
R7384:D130043K22Rik UTSW 13 24882605 missense probably damaging 1.00
R7398:D130043K22Rik UTSW 13 24893377 missense probably damaging 0.97
R7584:D130043K22Rik UTSW 13 24872370 missense probably damaging 1.00
R7585:D130043K22Rik UTSW 13 24885585 missense probably benign 0.01
R7588:D130043K22Rik UTSW 13 24887893 missense probably damaging 0.99
R7610:D130043K22Rik UTSW 13 24876002 missense probably benign 0.30
R7903:D130043K22Rik UTSW 13 24876012 missense probably damaging 0.98
R7966:D130043K22Rik UTSW 13 24893423 missense probably damaging 1.00
R8374:D130043K22Rik UTSW 13 24857979 missense probably benign 0.07
R8543:D130043K22Rik UTSW 13 24889869 missense probably benign 0.08
R8775:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8775-TAIL:D130043K22Rik UTSW 13 24856999 nonsense probably null
R8806:D130043K22Rik UTSW 13 24899635 missense probably benign 0.11
R8916:D130043K22Rik UTSW 13 24872271 missense probably benign
R9209:D130043K22Rik UTSW 13 24857107 missense possibly damaging 0.96
R9524:D130043K22Rik UTSW 13 24887893 missense possibly damaging 0.89
Z1177:D130043K22Rik UTSW 13 24856709 missense probably damaging 1.00
Z1177:D130043K22Rik UTSW 13 24856834 missense probably benign 0.39
Z1177:D130043K22Rik UTSW 13 24872248 missense possibly damaging 0.79
Z1177:D130043K22Rik UTSW 13 24880847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGAGTCTGCATTTGAAGTTG -3'
(R):5'- ATGTCTCCATAGTCCAGCAGC -3'

Sequencing Primer
(F):5'- GGATGACCTTGAACTCCTGGTC -3'
(R):5'- CAGGTCTGCGCACGAAAG -3'
Posted On 2020-01-23