Incidental Mutation 'R8014:Ext1'
ID617098
Institutional Source Beutler Lab
Gene Symbol Ext1
Ensembl Gene ENSMUSG00000061731
Gene Nameexostoses (multiple) 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8014 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location53064038-53346159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53075887 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 589 (I589V)
Ref Sequence ENSEMBL: ENSMUSP00000076505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077273] [ENSMUST00000133362]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077273
AA Change: I589V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076505
Gene: ENSMUSG00000061731
AA Change: I589V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 29 41 N/A INTRINSIC
Pfam:Exostosin 110 396 6e-64 PFAM
Pfam:Glyco_transf_64 480 729 1.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a lethal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,529 D7Y probably benign Het
9530053A07Rik G A 7: 28,137,541 R295H probably benign Het
Aff1 A G 5: 103,833,869 T625A possibly damaging Het
Aldh8a1 T C 10: 21,389,302 V276A probably benign Het
Alkbh3 T C 2: 94,001,513 D124G probably benign Het
Apob T A 12: 8,010,798 N3093K possibly damaging Het
Atp13a1 C T 8: 69,799,779 R608* probably null Het
Bbs7 A T 3: 36,594,387 I404K probably damaging Het
BC030867 A G 11: 102,257,899 N379D probably benign Het
Cacna2d1 A T 5: 16,342,691 T647S possibly damaging Het
Carmil1 T C 13: 24,036,321 E1140G possibly damaging Het
Ccdc158 C A 5: 92,649,030 E482D probably damaging Het
Ccdc92 A T 5: 124,836,026 H146Q probably damaging Het
Cntnap4 T A 8: 112,753,945 N341K probably damaging Het
Cog1 A G 11: 113,656,164 D528G probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
D130043K22Rik A T 13: 24,856,702 I36F probably damaging Het
Dis3 T A 14: 99,077,399 R954W possibly damaging Het
Fam20a T A 11: 109,685,506 E142D possibly damaging Het
Fars2 C T 13: 36,205,085 Q186* probably null Het
Fhdc1 A T 3: 84,474,639 M1K probably null Het
Gars T A 6: 55,073,407 F551Y probably benign Het
Gm28363 A G 1: 117,726,804 R58G probably benign Het
Gm49333 A T 16: 20,642,317 T618S probably benign Het
Gm8356 A T 14: 6,536,303 N58K probably damaging Het
Gm9758 A G 5: 14,911,440 V175A possibly damaging Het
Gpr182 T C 10: 127,751,005 T26A possibly damaging Het
Gpr19 A G 6: 134,869,473 Y416H probably damaging Het
Itgb7 T A 15: 102,222,652 S322C probably damaging Het
Kcnma1 T A 14: 23,373,143 I831F probably benign Het
Lrba A T 3: 86,417,971 D1912V probably damaging Het
Macf1 T A 4: 123,526,826 T212S probably benign Het
Map3k4 A T 17: 12,271,031 C504* probably null Het
Morc2a T C 11: 3,677,419 S281P probably damaging Het
Muc16 T C 9: 18,654,875 H2116R unknown Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1228 T A 2: 89,248,999 I220F probably damaging Het
Olfr1264 C A 2: 90,021,743 V108F possibly damaging Het
Olfr1469 A T 19: 13,410,811 T81S not run Het
Olfr153 A T 2: 87,532,164 M44L probably benign Het
Olfr155 T A 4: 43,854,958 F216L probably benign Het
Olfr697 C T 7: 106,741,617 V106I probably benign Het
Omg T C 11: 79,502,903 D43G possibly damaging Het
Pdia6 T C 12: 17,273,965 L66S probably damaging Het
Pds5a A G 5: 65,627,739 I930T possibly damaging Het
Piezo2 C T 18: 63,083,200 G1169S probably benign Het
Pkhd1 A G 1: 20,508,891 probably null Het
Plekhg1 A T 10: 3,957,758 R947W Het
Ptprs A C 17: 56,435,994 S383A probably damaging Het
Rin3 T A 12: 102,361,371 L193* probably null Het
Sgsh A G 11: 119,352,695 V67A probably damaging Het
Slc16a4 A G 3: 107,311,478 Y465C probably damaging Het
Stab2 C A 10: 86,850,903 S2259I possibly damaging Het
Tbc1d24 G A 17: 24,182,821 P385S possibly damaging Het
Tm4sf1 T C 3: 57,292,898 I99V probably benign Het
Tmem108 A T 9: 103,499,407 I281N probably benign Het
Usp31 T C 7: 121,649,257 S988G probably damaging Het
Usp44 G T 10: 93,852,709 probably null Het
Zbtb26 T A 2: 37,437,001 probably null Het
Zfp599 A G 9: 22,249,481 Y463H probably benign Het
Zfp750 T A 11: 121,513,017 D344V possibly damaging Het
Zmym5 T A 14: 56,794,426 K408N possibly damaging Het
Other mutations in Ext1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00710:Ext1 APN 15 53344873 missense probably damaging 1.00
IGL02081:Ext1 APN 15 53073446 nonsense probably null
IGL03147:Ext1 UTSW 15 53088072 missense probably damaging 0.98
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0047:Ext1 UTSW 15 53345146 missense probably benign
R0437:Ext1 UTSW 15 53106106 missense probably damaging 1.00
R0881:Ext1 UTSW 15 53344483 missense probably benign 0.23
R1882:Ext1 UTSW 15 53075792 missense probably damaging 1.00
R2135:Ext1 UTSW 15 53101744 missense possibly damaging 0.88
R2175:Ext1 UTSW 15 53068728 missense probably damaging 1.00
R2762:Ext1 UTSW 15 53344927 missense probably benign 0.29
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3162:Ext1 UTSW 15 53344604 missense possibly damaging 0.82
R3752:Ext1 UTSW 15 53075910 missense probably damaging 1.00
R3815:Ext1 UTSW 15 53345089 missense probably benign 0.05
R4096:Ext1 UTSW 15 53073357 missense probably damaging 1.00
R4298:Ext1 UTSW 15 53345125 missense probably benign 0.02
R4362:Ext1 UTSW 15 53107591 intron probably benign
R4550:Ext1 UTSW 15 53101786 missense probably damaging 0.99
R4647:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4648:Ext1 UTSW 15 53089987 missense possibly damaging 0.95
R4871:Ext1 UTSW 15 53092377 missense probably benign 0.37
R4954:Ext1 UTSW 15 53344492 missense probably damaging 1.00
R5010:Ext1 UTSW 15 53092412 missense probably damaging 1.00
R5153:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5155:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5328:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5385:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5542:Ext1 UTSW 15 53075817 missense probably damaging 1.00
R5555:Ext1 UTSW 15 53088143 missense probably damaging 1.00
R5779:Ext1 UTSW 15 53344553 missense probably damaging 0.99
R5874:Ext1 UTSW 15 53101752 missense possibly damaging 0.61
R6401:Ext1 UTSW 15 53106097 missense possibly damaging 0.94
R6604:Ext1 UTSW 15 53083159 missense probably damaging 0.99
R6847:Ext1 UTSW 15 53345154 missense probably benign
R6885:Ext1 UTSW 15 53101692 missense probably damaging 1.00
R7212:Ext1 UTSW 15 53345162 missense probably benign 0.00
R7315:Ext1 UTSW 15 53073387 missense probably damaging 1.00
R7361:Ext1 UTSW 15 53344723 missense probably damaging 1.00
R7474:Ext1 UTSW 15 53344489 missense probably damaging 0.98
R7853:Ext1 UTSW 15 53107485 missense probably damaging 0.96
R7860:Ext1 UTSW 15 53089939 missense possibly damaging 0.84
R8013:Ext1 UTSW 15 53075887 missense possibly damaging 0.78
R8725:Ext1 UTSW 15 53344669 missense possibly damaging 0.91
R8888:Ext1 UTSW 15 53092327 missense probably damaging 1.00
X0021:Ext1 UTSW 15 53345273 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGTTGTTAGAAATCTCAGCTCC -3'
(R):5'- GTCAAGCAGTCAGTTTAATTTGCTG -3'

Sequencing Primer
(F):5'- TCAGTGTGTAAGAGCACCCGAC -3'
(R):5'- CAGTTTAATTTGCTGATGAATATGGG -3'
Posted On2020-01-23