Incidental Mutation 'R8014:Map3k4'
ID 617101
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Name mitogen-activated protein kinase kinase kinase 4
Synonyms T-associated sex reversal, D17Rp17, D17Rp17e, Mekk4, Tas, RP17, MAPKKK4, MTK1
MMRRC Submission 067454-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R8014 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12446508-12537683 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 12489918 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 504 (C504*)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
AlphaFold O08648
Predicted Effect probably null
Transcript: ENSMUST00000089058
AA Change: C504*
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: C504*

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030458C11Rik C A 15: 12,824,615 (GRCm39) D7Y probably benign Het
Aff1 A G 5: 103,981,735 (GRCm39) T625A possibly damaging Het
Aldh8a1 T C 10: 21,265,201 (GRCm39) V276A probably benign Het
Alkbh3 T C 2: 93,831,858 (GRCm39) D124G probably benign Het
Apob T A 12: 8,060,798 (GRCm39) N3093K possibly damaging Het
Atp13a1 C T 8: 70,252,429 (GRCm39) R608* probably null Het
Bbs7 A T 3: 36,648,536 (GRCm39) I404K probably damaging Het
Cacna2d1 A T 5: 16,547,689 (GRCm39) T647S possibly damaging Het
Carmil1 T C 13: 24,220,304 (GRCm39) E1140G possibly damaging Het
Ccdc158 C A 5: 92,796,889 (GRCm39) E482D probably damaging Het
Ccdc92 A T 5: 124,913,090 (GRCm39) H146Q probably damaging Het
Cntnap4 T A 8: 113,480,577 (GRCm39) N341K probably damaging Het
Cog1 A G 11: 113,546,990 (GRCm39) D528G probably damaging Het
Cttnbp2 G C 6: 18,426,092 (GRCm39) A762G possibly damaging Het
D130043K22Rik A T 13: 25,040,685 (GRCm39) I36F probably damaging Het
Dis3 T A 14: 99,314,835 (GRCm39) R954W possibly damaging Het
Eef1ece2 A T 16: 20,461,067 (GRCm39) T618S probably benign Het
Ext1 T C 15: 52,939,283 (GRCm39) I589V possibly damaging Het
Fam20a T A 11: 109,576,332 (GRCm39) E142D possibly damaging Het
Fars2 C T 13: 36,389,068 (GRCm39) Q186* probably null Het
Fcgbpl1 G A 7: 27,836,966 (GRCm39) R295H probably benign Het
Fhdc1 A T 3: 84,381,946 (GRCm39) M1K probably null Het
Gars1 T A 6: 55,050,392 (GRCm39) F551Y probably benign Het
Gm28363 A G 1: 117,654,534 (GRCm39) R58G probably benign Het
Gm8356 A T 14: 17,692,450 (GRCm39) N58K probably damaging Het
Gm9758 A G 5: 14,961,454 (GRCm39) V175A possibly damaging Het
Gpr182 T C 10: 127,586,874 (GRCm39) T26A possibly damaging Het
Gpr19 A G 6: 134,846,436 (GRCm39) Y416H probably damaging Het
Hrob A G 11: 102,148,725 (GRCm39) N379D probably benign Het
Itgb7 T A 15: 102,131,087 (GRCm39) S322C probably damaging Het
Kcnma1 T A 14: 23,423,211 (GRCm39) I831F probably benign Het
Lrba A T 3: 86,325,278 (GRCm39) D1912V probably damaging Het
Macf1 T A 4: 123,420,619 (GRCm39) T212S probably benign Het
Morc2a T C 11: 3,627,419 (GRCm39) S281P probably damaging Het
Muc16 T C 9: 18,566,171 (GRCm39) H2116R unknown Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Omg T C 11: 79,393,729 (GRCm39) D43G possibly damaging Het
Or13c7 T A 4: 43,854,958 (GRCm39) F216L probably benign Het
Or2ag15 C T 7: 106,340,824 (GRCm39) V106I probably benign Het
Or4c122 T A 2: 89,079,343 (GRCm39) I220F probably damaging Het
Or4c3 C A 2: 89,852,087 (GRCm39) V108F possibly damaging Het
Or5b3 A T 19: 13,388,175 (GRCm39) T81S not run Het
Or5w22 A T 2: 87,362,508 (GRCm39) M44L probably benign Het
Pdia6 T C 12: 17,323,966 (GRCm39) L66S probably damaging Het
Pds5a A G 5: 65,785,082 (GRCm39) I930T possibly damaging Het
Piezo2 C T 18: 63,216,271 (GRCm39) G1169S probably benign Het
Pkhd1 A G 1: 20,579,115 (GRCm39) probably null Het
Plekhg1 A T 10: 3,907,758 (GRCm39) R947W Het
Ptprs A C 17: 56,742,994 (GRCm39) S383A probably damaging Het
Rin3 T A 12: 102,327,630 (GRCm39) L193* probably null Het
Sgsh A G 11: 119,243,521 (GRCm39) V67A probably damaging Het
Slc16a4 A G 3: 107,218,794 (GRCm39) Y465C probably damaging Het
Stab2 C A 10: 86,686,767 (GRCm39) S2259I possibly damaging Het
Tbc1d24 G A 17: 24,401,795 (GRCm39) P385S possibly damaging Het
Tm4sf1 T C 3: 57,200,319 (GRCm39) I99V probably benign Het
Tmem108 A T 9: 103,376,606 (GRCm39) I281N probably benign Het
Usp31 T C 7: 121,248,480 (GRCm39) S988G probably damaging Het
Usp44 G T 10: 93,688,571 (GRCm39) probably null Het
Zbtb26 T A 2: 37,327,013 (GRCm39) probably null Het
Zfp599 A G 9: 22,160,777 (GRCm39) Y463H probably benign Het
Zfp750 T A 11: 121,403,843 (GRCm39) D344V possibly damaging Het
Zmym5 T A 14: 57,031,883 (GRCm39) K408N possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12,451,877 (GRCm39) missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12,474,087 (GRCm39) missense probably benign 0.01
IGL01125:Map3k4 APN 17 12,490,849 (GRCm39) missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12,467,846 (GRCm39) missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12,482,815 (GRCm39) missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12,467,882 (GRCm39) missense probably benign 0.30
IGL02292:Map3k4 APN 17 12,454,045 (GRCm39) missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12,467,897 (GRCm39) missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12,490,497 (GRCm39) missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12,482,900 (GRCm39) missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12,454,840 (GRCm39) missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12,490,801 (GRCm39) missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12,491,036 (GRCm39) missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12,457,045 (GRCm39) missense probably benign 0.01
IGL03238:Map3k4 APN 17 12,490,045 (GRCm39) missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12,451,863 (GRCm39) missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12,457,076 (GRCm39) missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12,457,076 (GRCm39) missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12,466,950 (GRCm39) missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12,454,015 (GRCm39) missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12,489,902 (GRCm39) frame shift probably null
R0355:Map3k4 UTSW 17 12,473,058 (GRCm39) missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12,476,928 (GRCm39) splice site probably benign
R1103:Map3k4 UTSW 17 12,455,950 (GRCm39) splice site probably null
R1446:Map3k4 UTSW 17 12,475,681 (GRCm39) nonsense probably null
R1542:Map3k4 UTSW 17 12,454,793 (GRCm39) missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12,468,458 (GRCm39) missense probably benign 0.39
R1777:Map3k4 UTSW 17 12,490,617 (GRCm39) missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12,482,906 (GRCm39) missense probably benign 0.30
R1997:Map3k4 UTSW 17 12,473,882 (GRCm39) critical splice donor site probably null
R2042:Map3k4 UTSW 17 12,496,870 (GRCm39) missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12,482,954 (GRCm39) missense probably benign 0.00
R2939:Map3k4 UTSW 17 12,480,157 (GRCm39) missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12,480,157 (GRCm39) missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12,475,668 (GRCm39) missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12,454,880 (GRCm39) missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12,474,147 (GRCm39) missense probably benign 0.08
R4410:Map3k4 UTSW 17 12,467,885 (GRCm39) missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12,451,391 (GRCm39) missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12,482,932 (GRCm39) missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12,451,851 (GRCm39) missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12,467,861 (GRCm39) missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12,490,667 (GRCm39) missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12,490,906 (GRCm39) missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12,490,787 (GRCm39) missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12,468,382 (GRCm39) critical splice donor site probably null
R4980:Map3k4 UTSW 17 12,490,958 (GRCm39) missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12,451,321 (GRCm39) missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12,490,497 (GRCm39) missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12,466,195 (GRCm39) missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12,462,445 (GRCm39) nonsense probably null
R5824:Map3k4 UTSW 17 12,448,526 (GRCm39) missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12,490,303 (GRCm39) missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12,482,945 (GRCm39) missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12,490,954 (GRCm39) missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12,468,470 (GRCm39) missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12,461,579 (GRCm39) missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12,479,378 (GRCm39) missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12,490,231 (GRCm39) missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12,451,297 (GRCm39) critical splice donor site probably null
R6909:Map3k4 UTSW 17 12,489,872 (GRCm39) missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12,479,456 (GRCm39) nonsense probably null
R6970:Map3k4 UTSW 17 12,467,803 (GRCm39) missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12,490,354 (GRCm39) missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12,490,955 (GRCm39) missense probably benign 0.00
R7267:Map3k4 UTSW 17 12,490,536 (GRCm39) nonsense probably null
R7322:Map3k4 UTSW 17 12,489,833 (GRCm39) missense probably damaging 1.00
R7522:Map3k4 UTSW 17 12,480,219 (GRCm39) missense probably benign 0.39
R7554:Map3k4 UTSW 17 12,451,300 (GRCm39) missense probably damaging 1.00
R7554:Map3k4 UTSW 17 12,451,301 (GRCm39) nonsense probably null
R7681:Map3k4 UTSW 17 12,537,430 (GRCm39) missense unknown
R7734:Map3k4 UTSW 17 12,482,998 (GRCm39) missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12,490,030 (GRCm39) missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12,489,918 (GRCm39) nonsense probably null
R8235:Map3k4 UTSW 17 12,458,968 (GRCm39) splice site probably null
R8294:Map3k4 UTSW 17 12,537,500 (GRCm39) missense unknown
R8528:Map3k4 UTSW 17 12,451,821 (GRCm39) missense probably damaging 1.00
R8858:Map3k4 UTSW 17 12,490,759 (GRCm39) missense probably damaging 1.00
R8924:Map3k4 UTSW 17 12,490,433 (GRCm39) missense probably benign 0.00
R9063:Map3k4 UTSW 17 12,482,878 (GRCm39) missense probably damaging 1.00
R9224:Map3k4 UTSW 17 12,456,973 (GRCm39) missense probably damaging 0.99
R9446:Map3k4 UTSW 17 12,451,375 (GRCm39) missense probably damaging 1.00
R9486:Map3k4 UTSW 17 12,489,860 (GRCm39) missense probably damaging 1.00
R9488:Map3k4 UTSW 17 12,489,860 (GRCm39) missense probably damaging 1.00
R9591:Map3k4 UTSW 17 12,454,795 (GRCm39) missense possibly damaging 0.91
R9617:Map3k4 UTSW 17 12,476,871 (GRCm39) missense possibly damaging 0.67
R9722:Map3k4 UTSW 17 12,490,523 (GRCm39) missense probably benign 0.01
X0067:Map3k4 UTSW 17 12,482,981 (GRCm39) missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12,490,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAACCTACCTCCACTGGACG -3'
(R):5'- GGCCAGTGTTTGAAATCCCC -3'

Sequencing Primer
(F):5'- GGTCGTCCTTCACCAGAGCTAC -3'
(R):5'- AGTGTTTGAAATCCCCTCCCC -3'
Posted On 2020-01-23