Incidental Mutation 'R8015:Fam126b'
ID617106
Institutional Source Beutler Lab
Gene Symbol Fam126b
Ensembl Gene ENSMUSG00000038174
Gene Namefamily with sequence similarity 126, member B
SynonymsD1Ertd53e
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58522806-58586323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58535482 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 300 (V300A)
Ref Sequence ENSEMBL: ENSMUSP00000123728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038372] [ENSMUST00000097724] [ENSMUST00000161600] [ENSMUST00000187717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038372
AA Change: V300A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038718
Gene: ENSMUSG00000038174
AA Change: V300A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000097724
AA Change: V300A

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095331
Gene: ENSMUSG00000038174
AA Change: V300A

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 3.3e-126 PFAM
low complexity region 374 399 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161600
AA Change: V300A

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123728
Gene: ENSMUSG00000038174
AA Change: V300A

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 1.7e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187717
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Fam126b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Fam126b APN 1 58540253 splice site probably benign
IGL00468:Fam126b APN 1 58530232 missense probably benign 0.25
IGL00701:Fam126b APN 1 58535482 missense possibly damaging 0.59
IGL00795:Fam126b APN 1 58552179 missense probably damaging 1.00
IGL02023:Fam126b APN 1 58530115 missense possibly damaging 0.53
IGL02501:Fam126b APN 1 58540191 missense probably damaging 1.00
IGL02657:Fam126b APN 1 58535402 missense probably damaging 1.00
IGL02970:Fam126b APN 1 58539617 missense probably damaging 1.00
IGL03221:Fam126b APN 1 58540186 missense probably benign 0.00
IGL03240:Fam126b APN 1 58529917 missense probably damaging 1.00
PIT4812001:Fam126b UTSW 1 58548703 missense possibly damaging 0.78
R0455:Fam126b UTSW 1 58534479 splice site probably benign
R1479:Fam126b UTSW 1 58552268 nonsense probably null
R1529:Fam126b UTSW 1 58539607 missense probably benign 0.00
R4275:Fam126b UTSW 1 58529933 missense probably benign
R5164:Fam126b UTSW 1 58535438 missense probably benign 0.13
R6332:Fam126b UTSW 1 58529875 missense probably damaging 0.99
R6352:Fam126b UTSW 1 58557312 missense probably damaging 1.00
R6549:Fam126b UTSW 1 58539600 missense probably benign 0.03
R7034:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7036:Fam126b UTSW 1 58535537 missense probably benign 0.17
R7100:Fam126b UTSW 1 58534494 missense possibly damaging 0.94
R7237:Fam126b UTSW 1 58529948 nonsense probably null
R7378:Fam126b UTSW 1 58530034 missense probably benign 0.00
R7403:Fam126b UTSW 1 58548702 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCTTAAAGCAACTTTCTCCCTG -3'
(R):5'- CTTTGACACAGTGGTCCTTTTATAC -3'

Sequencing Primer
(F):5'- AGCAACTTTCTCCCTGTTTTTATTAC -3'
(R):5'- GTGGTCCTTTTATACGAAGTTACAC -3'
Posted On2020-01-23