Incidental Mutation 'R8015:Cacnb4'
ID617111
Institutional Source Beutler Lab
Gene Symbol Cacnb4
Ensembl Gene ENSMUSG00000017412
Gene Namecalcium channel, voltage-dependent, beta 4 subunit
SynonymsCchb4, 3110038O15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location52428320-52676831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52464643 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 241 (L241P)
Ref Sequence ENSEMBL: ENSMUSP00000077438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078324] [ENSMUST00000102760] [ENSMUST00000102761] [ENSMUST00000178799]
PDB Structure
BETA4 SUBUNIT OF CA2+ CHANNEL [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078324
AA Change: L241P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077438
Gene: ENSMUSG00000017412
AA Change: L241P

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 5.4e-27 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
low complexity region 193 206 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102760
AA Change: L208P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099821
Gene: ENSMUSG00000017412
AA Change: L208P

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 16 57 9.4e-28 PFAM
SH3 61 126 4.96e-2 SMART
low complexity region 139 156 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
GuKc 184 365 3.46e-37 SMART
low complexity region 432 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102761
AA Change: L195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099822
Gene: ENSMUSG00000017412
AA Change: L195P

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 3 44 4.8e-27 PFAM
SH3 48 113 4.96e-2 SMART
low complexity region 126 143 N/A INTRINSIC
low complexity region 147 160 N/A INTRINSIC
GuKc 171 352 3.46e-37 SMART
low complexity region 419 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178799
AA Change: L241P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136811
Gene: ENSMUSG00000017412
AA Change: L241P

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 49 90 1.3e-24 PFAM
SH3 94 159 4.96e-2 SMART
low complexity region 172 189 N/A INTRINSIC
GuKc 217 398 3.46e-37 SMART
low complexity region 465 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta subunit family of voltage-dependent calcium channel complex proteins. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization and consist of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Various versions of each of these subunits exist, either expressed from similar genes or the result of alternative splicing. The protein encoded by this locus plays an important role in calcium channel function by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Certain mutations in this gene have been associated with idiopathic generalized epilepsy (IGE), juvenile myoclonic epilepsy (JME), and episodic ataxia, type 5. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous mutants have lethargic behavior, unstable gait and seizures, with peripheral motor nerves showing reduced conduction velocity and prolonged distal latency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Cacnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Cacnb4 APN 2 52477712 missense possibly damaging 0.46
IGL01328:Cacnb4 APN 2 52464625 missense probably damaging 1.00
IGL01801:Cacnb4 APN 2 52434711 missense probably benign 0.15
IGL01992:Cacnb4 APN 2 52465670 missense probably damaging 1.00
IGL03030:Cacnb4 APN 2 52474882 missense probably damaging 1.00
R0789:Cacnb4 UTSW 2 52451883 missense probably damaging 1.00
R1069:Cacnb4 UTSW 2 52455611 missense probably damaging 1.00
R1646:Cacnb4 UTSW 2 52474900 missense possibly damaging 0.87
R2050:Cacnb4 UTSW 2 52469586 missense probably damaging 0.99
R3939:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R3941:Cacnb4 UTSW 2 52469489 missense probably damaging 1.00
R4455:Cacnb4 UTSW 2 52465653 missense probably damaging 1.00
R4497:Cacnb4 UTSW 2 52477771 missense probably damaging 1.00
R4707:Cacnb4 UTSW 2 52474915 missense probably benign 0.45
R4824:Cacnb4 UTSW 2 52675810 missense probably benign 0.00
R4957:Cacnb4 UTSW 2 52558291 missense probably damaging 0.99
R5913:Cacnb4 UTSW 2 52434784 intron probably benign
R6372:Cacnb4 UTSW 2 52434667 missense probably benign 0.00
R6945:Cacnb4 UTSW 2 52474954 missense probably damaging 1.00
R7557:Cacnb4 UTSW 2 52469567 missense probably damaging 1.00
R7821:Cacnb4 UTSW 2 52434508 missense possibly damaging 0.91
R8043:Cacnb4 UTSW 2 52465651 missense probably damaging 1.00
Z1176:Cacnb4 UTSW 2 52675812 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTTCCAGTGTGTACTCC -3'
(R):5'- AGCAGCTGTGTCTGATTATCATG -3'

Sequencing Primer
(F):5'- TGTGTACTCCCTGGAACACTGAG -3'
(R):5'- TCTGAGACCCACTGTAGCTG -3'
Posted On2020-01-23