Mutagenetix > Incidental Mutations

Incidental Mutation 'R8015:Spata16'

617113

Institutional Source

Beutler Lab

Gene Symbol

Spata16

Ensembl Gene

ENSMUSG00000039335

Gene Name

spermatogenesis associated 16

Synonyms

spermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R8015 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26637620-26983212 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26667659 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 110 (T110A)

Ref Sequence

ENSEMBL: ENSMUSP00000043378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]

Predicted Effect

probably benign
Transcript: ENSMUST00000047005
AA Change: T110A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335
AA Change: T110A

Domain	Start	End	E-Value	Type
Pfam:NYD-SP12_N	5	569	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000108305
AA Change: T110A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335
AA Change: T110A

Domain	Start	End	E-Value	Type
Pfam:NYD-SP12_N	1	534	N/A	PFAM

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alad	A	G	4: 62,511,922	V121A	probably damaging	Het
Anapc2	T	A	2: 25,284,676	Y684N	probably benign	Het
Arntl2	T	C	6: 146,820,590	S220P	probably damaging	Het
Atp10a	G	T	7: 58,803,497	R808L	probably benign	Het
Best2	A	G	8: 85,009,354	V317A	probably damaging	Het
Cacnb4	A	G	2: 52,464,643	L241P	probably damaging	Het
Col6a5	T	C	9: 105,881,741	T2089A	possibly damaging	Het
Cttnbp2	G	C	6: 18,426,093	A762G	possibly damaging	Het
Defb13	G	T	8: 21,946,812	V8F	possibly damaging	Het
Dpp6	C	T	5: 26,817,810		probably benign	Het
Fam126b	A	G	1: 58,535,482	V300A	possibly damaging	Het
Fat4	A	G	3: 38,981,916	D3239G	possibly damaging	Het
Gm16486	C	T	8: 70,716,792	S1177L	probably benign	Het
Gm5615	A	G	9: 36,534,954	V54A	probably benign	Het
Hmcn1	T	G	1: 150,598,311	R4793S	possibly damaging	Het
Hspa1a	T	A	17: 34,970,649	Q426L	probably damaging	Het
Il20rb	T	A	9: 100,474,894	Y61F	probably damaging	Het
Itgb1	T	A	8: 128,722,401	V496D	possibly damaging	Het
Jakmip1	T	C	5: 37,159,765	S102P	unknown	Het
Jmjd8	T	A	17: 25,829,328	F108I	probably damaging	Het
Krtap15	A	G	16: 88,829,209	T55A	possibly damaging	Het
Lce3d	A	T	3: 92,958,503		probably benign	Het
Lnpep	C	A	17: 17,546,499	V702F	probably damaging	Het
Lox	G	A	18: 52,528,348	A218V	probably benign	Het
Mcrs1	T	A	15: 99,248,854	K99*	probably null	Het
Mfsd8	G	A	3: 40,846,835		probably benign	Het
Msto1	G	T	3: 88,911,556	P264Q	probably damaging	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1002	G	T	2: 85,647,792	H176Q	probably damaging	Het
Olfr1368	T	C	13: 21,142,133	D308G	probably benign	Het
Pate2	A	T	9: 35,670,518	H36L	probably damaging	Het
Phf20l1	T	G	15: 66,639,948	N925K	possibly damaging	Het
Pnliprp2	G	T	19: 58,766,282	V253F	probably damaging	Het
Polr2b	A	G	5: 77,336,506	D745G	probably damaging	Het
Ptdss1	T	A	13: 66,963,343	W158R	possibly damaging	Het
Rcn3	T	A	7: 45,084,907	I226F	probably damaging	Het
Rhbdl1	C	G	17: 25,835,851	V157L	probably damaging	Het
Slc30a2	A	G	4: 134,347,450	T173A	probably benign	Het
Specc1l	A	G	10: 75,241,068	K53E	probably benign	Het
Speg	G	T	1: 75,415,421		probably benign	Het
Spta1	T	A	1: 174,240,171	C2055S	probably damaging	Het
Tex14	G	A	11: 87,509,600	R406Q	probably benign	Het
Tmem150b	C	T	7: 4,716,328	G198S	probably null	Het
Tnfrsf14	T	G	4: 154,926,661	Q81P	probably damaging	Het
Txndc17	A	G	11: 72,207,742	K40R	probably benign	Het
Ube3a	T	A	7: 59,284,756	V560E	probably damaging	Het
Vmn1r14	A	G	6: 57,234,030	M198V	probably damaging	Het
Vmn2r23	G	A	6: 123,704,541	S136N	probably benign	Het
Vmn2r31	C	T	7: 7,384,200	V791I	probably damaging	Het
Wdfy4	T	C	14: 33,107,747	Y984C		Het
Zfp386	T	G	12: 116,059,407	D248E	probably damaging	Het

Other mutations in Spata16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Spata16	APN	3	26924262	missense	probably damaging	0.98
IGL01017:Spata16	APN	3	26840722	missense	possibly damaging	0.93
IGL01129:Spata16	APN	3	26913184	splice site	probably benign
IGL01330:Spata16	APN	3	26914715	missense	probably damaging	0.99
IGL02033:Spata16	APN	3	26913334	critical splice donor site	probably null
IGL02069:Spata16	APN	3	26732795	nonsense	probably null
IGL02231:Spata16	APN	3	26913264	missense	probably damaging	1.00
R0084:Spata16	UTSW	3	26667410	missense	possibly damaging	0.95
R0109:Spata16	UTSW	3	26913267	missense	probably damaging	0.97
R0109:Spata16	UTSW	3	26913267	missense	probably damaging	0.97
R0325:Spata16	UTSW	3	26667456	missense	probably damaging	0.98
R0811:Spata16	UTSW	3	26913338	splice site	probably benign
R2061:Spata16	UTSW	3	26924370	missense	probably damaging	0.99
R3148:Spata16	UTSW	3	26878712	critical splice donor site	probably null
R4837:Spata16	UTSW	3	26732932	missense	possibly damaging	0.93
R4972:Spata16	UTSW	3	26840723	missense	possibly damaging	0.93
R5129:Spata16	UTSW	3	26667564	missense	probably damaging	0.98
R5235:Spata16	UTSW	3	26667632	missense	probably benign	0.00
R5458:Spata16	UTSW	3	26777537	missense	probably damaging	0.99
R6578:Spata16	UTSW	3	26667548	nonsense	probably null
R7069:Spata16	UTSW	3	26927334	missense	probably damaging	0.99
R7256:Spata16	UTSW	3	26667867	missense	probably benign	0.25
R7936:Spata16	UTSW	3	26667423	missense	possibly damaging	0.71
R8060:Spata16	UTSW	3	26840720	missense	probably damaging	0.99
R8161:Spata16	UTSW	3	26840662	missense	probably benign	0.16
R8459:Spata16	UTSW	3	26667527	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGAAATGCAAGCTGAAGCCTC -3'
(R):5'- AGCTGGCATCCTTTAAGGCTAC -3'

Sequencing Primer
(F):5'- GCCTCAGCTGAGAGAGTAAAACTC -3'
(R):5'- GGCATCCTTTAAGGCTACCTGAAG -3'

Posted On

2020-01-23