Incidental Mutation 'R8015:Tnfrsf14'
ID617119
Institutional Source Beutler Lab
Gene Symbol Tnfrsf14
Ensembl Gene ENSMUSG00000042333
Gene Nametumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
SynonymsAtar, Hvem, HveA
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154921933-154928563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 154926661 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 81 (Q81P)
Ref Sequence ENSEMBL: ENSMUSP00000151575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123514] [ENSMUST00000137803] [ENSMUST00000145296] [ENSMUST00000152687] [ENSMUST00000219534]
Predicted Effect probably damaging
Transcript: ENSMUST00000123514
AA Change: Q81P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116757
Gene: ENSMUSG00000042333
AA Change: Q81P

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TNFR 42 75 1.19e-2 SMART
TNFR 78 119 1.61e-8 SMART
TNFR 121 162 2.49e-5 SMART
TNFR 165 203 2.63e-4 SMART
transmembrane domain 208 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137803
AA Change: Q26P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000145296
AA Change: Q81P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000152687
SMART Domains Protein: ENSMUSP00000117890
Gene: ENSMUSG00000042333

DomainStartEndE-ValueType
TNFR 37 78 2.49e-5 SMART
TNFR 81 119 2.63e-4 SMART
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219534
AA Change: Q81P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF (tumor necrosis factor) receptor superfamily. The encoded protein functions in signal transduction pathways that activate inflammatory and inhibitory T-cell immune response. It binds herpes simplex virus (HSV) viral envelope glycoprotein D (gD), mediating its entry into cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a null allele are less susceptible to induced colitis. Homozygotes for a second null allele exhibit enhanced responses to various T cell stimuli and are more susceptible to developing autoimmune diseases. Homozygotes for a third null allele show reduced length of allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Tnfrsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02680:Tnfrsf14 APN 4 154924470 nonsense probably null
che UTSW 4 154925380 nonsense probably null
trotter UTSW 4 154926598 critical splice donor site probably null
R0271:Tnfrsf14 UTSW 4 154926597 critical splice donor site probably null
R0605:Tnfrsf14 UTSW 4 154925380 nonsense probably null
R1738:Tnfrsf14 UTSW 4 154925331 missense probably damaging 1.00
R1756:Tnfrsf14 UTSW 4 154925322 missense possibly damaging 0.90
R5371:Tnfrsf14 UTSW 4 154922477 splice site probably null
R5869:Tnfrsf14 UTSW 4 154926598 critical splice donor site probably null
R6113:Tnfrsf14 UTSW 4 154924492 missense possibly damaging 0.64
R7790:Tnfrsf14 UTSW 4 154923293 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCACAATAGCAGGAAGGTC -3'
(R):5'- TAGGAAGCCCCATCTCTGTG -3'

Sequencing Primer
(F):5'- AAGGTCAGGCTGCGGTTC -3'
(R):5'- AGGCCAACAAGTCCTGTG -3'
Posted On2020-01-23