Incidental Mutation 'R0678:Rnf31'
ID 61712
Institutional Source Beutler Lab
Gene Symbol Rnf31
Ensembl Gene ENSMUSG00000047098
Gene Name ring finger protein 31
Synonyms Paul, HOIP
MMRRC Submission 038863-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0678 (G1)
Quality Score 187
Status Not validated
Chromosome 14
Chromosomal Location 55829199-55841131 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 55839170 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 66 (Y66*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000137296] [ENSMUST00000138037]
AlphaFold Q924T7
Predicted Effect probably null
Transcript: ENSMUST00000019443
AA Change: Y927*
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: Y927*

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably benign
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137296
SMART Domains Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 66 151 6.8e-17 PFAM
Blast:RING 214 257 3e-17 BLAST
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 404 428 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140178
AA Change: Y772*
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: Y772*

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably null
Transcript: ENSMUST00000227708
AA Change: Y66*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Egfl7 C T 2: 26,480,952 (GRCm39) R155C probably benign Het
Fat4 T C 3: 38,943,843 (GRCm39) I912T probably damaging Het
H2-M5 A G 17: 37,300,034 (GRCm39) F47L possibly damaging Het
H2-T24 A T 17: 36,328,333 (GRCm39) F50Y probably damaging Het
Hif1a A G 12: 73,990,965 (GRCm39) probably null Het
Ints11 T C 4: 155,972,210 (GRCm39) I405T probably damaging Het
Kmt2d A T 15: 98,748,294 (GRCm39) probably benign Het
Pld1 T A 3: 28,174,933 (GRCm39) V857D probably damaging Het
Ptgr3 A G 18: 84,113,287 (GRCm39) E321G probably benign Het
Rab11fip3 G A 17: 26,287,821 (GRCm39) P111S probably benign Het
Rad17 A T 13: 100,781,692 (GRCm39) I35N possibly damaging Het
Sec31a T C 5: 100,555,084 (GRCm39) I45M possibly damaging Het
Sele T C 1: 163,882,298 (GRCm39) probably null Het
Serpina3i G T 12: 104,232,978 (GRCm39) probably null Het
Sp6 T A 11: 96,912,607 (GRCm39) W107R probably damaging Het
Sphkap A T 1: 83,256,349 (GRCm39) W467R probably benign Het
Thbs1 T C 2: 117,953,387 (GRCm39) F935L probably damaging Het
Vmn2r8 T A 5: 108,948,412 (GRCm39) H492L probably benign Het
Xrcc2 A G 5: 25,903,261 (GRCm39) S37P possibly damaging Het
Zfand1 T A 3: 10,413,577 (GRCm39) I31L probably benign Het
Zfr G A 15: 12,184,171 (GRCm39) D1058N probably damaging Het
Other mutations in Rnf31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf31 APN 14 55,829,776 (GRCm39) splice site probably null
IGL01532:Rnf31 APN 14 55,840,080 (GRCm39) missense probably damaging 0.99
IGL02118:Rnf31 APN 14 55,836,569 (GRCm39) missense probably damaging 1.00
IGL02272:Rnf31 APN 14 55,836,239 (GRCm39) missense probably damaging 1.00
IGL02893:Rnf31 APN 14 55,836,566 (GRCm39) missense probably damaging 1.00
IGL02939:Rnf31 APN 14 55,833,131 (GRCm39) missense probably benign 0.30
R0285:Rnf31 UTSW 14 55,838,846 (GRCm39) missense probably damaging 0.96
R0924:Rnf31 UTSW 14 55,830,459 (GRCm39) unclassified probably benign
R1386:Rnf31 UTSW 14 55,834,221 (GRCm39) missense probably damaging 1.00
R1507:Rnf31 UTSW 14 55,836,439 (GRCm39) nonsense probably null
R2122:Rnf31 UTSW 14 55,833,654 (GRCm39) missense probably damaging 1.00
R2164:Rnf31 UTSW 14 55,829,994 (GRCm39) missense possibly damaging 0.90
R3714:Rnf31 UTSW 14 55,840,851 (GRCm39) missense probably damaging 1.00
R3921:Rnf31 UTSW 14 55,838,599 (GRCm39) missense probably damaging 1.00
R4348:Rnf31 UTSW 14 55,838,555 (GRCm39) frame shift probably null
R4349:Rnf31 UTSW 14 55,838,555 (GRCm39) frame shift probably null
R4350:Rnf31 UTSW 14 55,838,555 (GRCm39) frame shift probably null
R4351:Rnf31 UTSW 14 55,838,555 (GRCm39) frame shift probably null
R4353:Rnf31 UTSW 14 55,838,555 (GRCm39) frame shift probably null
R4472:Rnf31 UTSW 14 55,840,777 (GRCm39) missense probably damaging 1.00
R5004:Rnf31 UTSW 14 55,829,639 (GRCm39) missense probably damaging 1.00
R5245:Rnf31 UTSW 14 55,839,163 (GRCm39) missense probably damaging 1.00
R5286:Rnf31 UTSW 14 55,829,693 (GRCm39) missense probably damaging 1.00
R5669:Rnf31 UTSW 14 55,834,161 (GRCm39) missense probably damaging 1.00
R5750:Rnf31 UTSW 14 55,836,143 (GRCm39) missense probably damaging 1.00
R6377:Rnf31 UTSW 14 55,832,984 (GRCm39) missense probably damaging 1.00
R7009:Rnf31 UTSW 14 55,830,008 (GRCm39) missense probably benign 0.00
R7018:Rnf31 UTSW 14 55,829,690 (GRCm39) missense probably damaging 1.00
R7670:Rnf31 UTSW 14 55,831,818 (GRCm39) missense probably benign 0.08
R7876:Rnf31 UTSW 14 55,830,534 (GRCm39) critical splice donor site probably null
R8490:Rnf31 UTSW 14 55,833,566 (GRCm39) missense probably damaging 1.00
R8818:Rnf31 UTSW 14 55,832,396 (GRCm39) missense probably benign 0.10
R8900:Rnf31 UTSW 14 55,833,689 (GRCm39) missense probably damaging 1.00
R9246:Rnf31 UTSW 14 55,833,698 (GRCm39) missense probably benign 0.01
R9454:Rnf31 UTSW 14 55,833,609 (GRCm39) missense
R9526:Rnf31 UTSW 14 55,836,269 (GRCm39) critical splice donor site probably null
R9756:Rnf31 UTSW 14 55,836,582 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACGCCTTTTACGCCAAGAATG -3'
(R):5'- TCTGACACTTACCTCCAGGGACTG -3'

Sequencing Primer
(F):5'- CCTTTTACGCCAAGAATGTGAGTG -3'
(R):5'- AGCTGGAGGCTCTGTATTAAAC -3'
Posted On 2013-07-30