Incidental Mutation 'R8015:Jakmip1'
ID617120
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name
SynonymsGababrbp, C330021K24Rik, Marlin-1, 5830437M04Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location37113784-37117473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37159765 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 102 (S102P)
Ref Sequence ENSEMBL: ENSMUSP00000147157 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000207866
AA Change: S102P
Predicted Effect probably benign
Transcript: ENSMUST00000232332
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37085406 nonsense probably null
IGL01350:Jakmip1 APN 5 37085431 missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37100768 missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37120980 missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37120987 missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37104856 missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37100843 nonsense probably null
R0036:Jakmip1 UTSW 5 37134304 missense probably null 0.38
R0194:Jakmip1 UTSW 5 37134283 missense possibly damaging 0.77
R0442:Jakmip1 UTSW 5 37135553 splice site probably null
R0555:Jakmip1 UTSW 5 37118873 missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37134249 missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37091128 missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R1470:Jakmip1 UTSW 5 37100838 missense probably damaging 1.00
R2339:Jakmip1 UTSW 5 37091199 missense probably benign 0.05
R2397:Jakmip1 UTSW 5 37100743 missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37141805 nonsense probably null
R2973:Jakmip1 UTSW 5 37091527 missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37128622 missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37091275 missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37104901 missense probably benign 0.05
R5842:Jakmip1 UTSW 5 37107268 missense probably damaging 1.00
R5926:Jakmip1 UTSW 5 37085280 unclassified probably benign
R6258:Jakmip1 UTSW 5 37141760 nonsense probably null
R6776:Jakmip1 UTSW 5 37187154 missense probably damaging 0.97
R6880:Jakmip1 UTSW 5 37105623 missense possibly damaging 0.95
R6961:Jakmip1 UTSW 5 37173353 missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37124941 missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37174765 nonsense probably null
R7173:Jakmip1 UTSW 5 37091364 missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37127473 missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37117460 missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37118804 missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37173207 missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37175154 missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37173571 missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37127458 missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37171001 missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37134273 missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37117497 missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37175180 missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R7971:Jakmip1 UTSW 5 37104864 missense probably damaging 1.00
R8039:Jakmip1 UTSW 5 37100772 missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37154644 missense unknown
R8070:Jakmip1 UTSW 5 37173287 missense probably benign 0.10
RF014:Jakmip1 UTSW 5 37174526 missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37118903 missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37120986 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37091583 missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37175307 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCCCTTTGAGGTAGGACAGAG -3'
(R):5'- ACTTCCTGACCTCAAGGACC -3'

Sequencing Primer
(F):5'- ACCATGACTTTGAGACCAGTCTGG -3'
(R):5'- CTCAAGGACCCAGGCATGAG -3'
Posted On2020-01-23