Mutagenetix > Incidental Mutations

Incidental Mutation 'R8015:Vmn2r23'

617124

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R8015 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 123704541 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 136 (S136N)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

Predicted Effect

probably benign
Transcript: ENSMUST00000172391
AA Change: S136N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: S136N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (51/51)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alad	A	G	4: 62,511,922	V121A	probably damaging	Het
Anapc2	T	A	2: 25,284,676	Y684N	probably benign	Het
Arntl2	T	C	6: 146,820,590	S220P	probably damaging	Het
Atp10a	G	T	7: 58,803,497	R808L	probably benign	Het
Best2	A	G	8: 85,009,354	V317A	probably damaging	Het
Cacnb4	A	G	2: 52,464,643	L241P	probably damaging	Het
Col6a5	T	C	9: 105,881,741	T2089A	possibly damaging	Het
Cttnbp2	G	C	6: 18,426,093	A762G	possibly damaging	Het
Defb13	G	T	8: 21,946,812	V8F	possibly damaging	Het
Dpp6	C	T	5: 26,817,810		probably benign	Het
Fam126b	A	G	1: 58,535,482	V300A	possibly damaging	Het
Fat4	A	G	3: 38,981,916	D3239G	possibly damaging	Het
Gm16486	C	T	8: 70,716,792	S1177L	probably benign	Het
Gm5615	A	G	9: 36,534,954	V54A	probably benign	Het
Hmcn1	T	G	1: 150,598,311	R4793S	possibly damaging	Het
Hspa1a	T	A	17: 34,970,649	Q426L	probably damaging	Het
Il20rb	T	A	9: 100,474,894	Y61F	probably damaging	Het
Itgb1	T	A	8: 128,722,401	V496D	possibly damaging	Het
Jakmip1	T	C	5: 37,159,765	S102P	unknown	Het
Jmjd8	T	A	17: 25,829,328	F108I	probably damaging	Het
Krtap15	A	G	16: 88,829,209	T55A	possibly damaging	Het
Lce3d	A	T	3: 92,958,503		probably benign	Het
Lnpep	C	A	17: 17,546,499	V702F	probably damaging	Het
Lox	G	A	18: 52,528,348	A218V	probably benign	Het
Mcrs1	T	A	15: 99,248,854	K99*	probably null	Het
Mfsd8	G	A	3: 40,846,835		probably benign	Het
Msto1	G	T	3: 88,911,556	P264Q	probably damaging	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1002	G	T	2: 85,647,792	H176Q	probably damaging	Het
Olfr1368	T	C	13: 21,142,133	D308G	probably benign	Het
Pate2	A	T	9: 35,670,518	H36L	probably damaging	Het
Phf20l1	T	G	15: 66,639,948	N925K	possibly damaging	Het
Pnliprp2	G	T	19: 58,766,282	V253F	probably damaging	Het
Polr2b	A	G	5: 77,336,506	D745G	probably damaging	Het
Ptdss1	T	A	13: 66,963,343	W158R	possibly damaging	Het
Rcn3	T	A	7: 45,084,907	I226F	probably damaging	Het
Rhbdl1	C	G	17: 25,835,851	V157L	probably damaging	Het
Slc30a2	A	G	4: 134,347,450	T173A	probably benign	Het
Spata16	A	G	3: 26,667,659	T110A	probably benign	Het
Specc1l	A	G	10: 75,241,068	K53E	probably benign	Het
Speg	G	T	1: 75,415,421		probably benign	Het
Spta1	T	A	1: 174,240,171	C2055S	probably damaging	Het
Tex14	G	A	11: 87,509,600	R406Q	probably benign	Het
Tmem150b	C	T	7: 4,716,328	G198S	probably null	Het
Tnfrsf14	T	G	4: 154,926,661	Q81P	probably damaging	Het
Txndc17	A	G	11: 72,207,742	K40R	probably benign	Het
Ube3a	T	A	7: 59,284,756	V560E	probably damaging	Het
Vmn1r14	A	G	6: 57,234,030	M198V	probably damaging	Het
Vmn2r31	C	T	7: 7,384,200	V791I	probably damaging	Het
Wdfy4	T	C	14: 33,107,747	Y984C		Het
Zfp386	T	G	12: 116,059,407	D248E	probably damaging	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6576:Vmn2r23	UTSW	6	123733273	missense	probably benign
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCACATGTTGGCAATGG -3'
(R):5'- GCAAAGGACATTTTCTTGGGAGTG -3'

Sequencing Primer
(F):5'- CAGCACATGTTGGCAATGGTTTTTG -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'

Posted On

2020-01-23