Incidental Mutation 'R8015:Vmn2r23'
ID 617124
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8015 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123704541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 136 (S136N)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: S136N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: S136N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Dpp6 C T 5: 26,817,810 probably benign Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lce3d A T 3: 92,958,503 probably benign Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Speg G T 1: 75,415,421 probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123741823 missense probably damaging 1.00
R9189:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R9495:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
R9514:Vmn2r23 UTSW 6 123712713 missense probably benign 0.30
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGCACATGTTGGCAATGG -3'
(R):5'- GCAAAGGACATTTTCTTGGGAGTG -3'

Sequencing Primer
(F):5'- CAGCACATGTTGGCAATGGTTTTTG -3'
(R):5'- CATTTTCTTGGGAGTGGTAAGAATAC -3'
Posted On 2020-01-23