Incidental Mutation 'R8015:Arntl2'
ID617125
Institutional Source Beutler Lab
Gene Symbol Arntl2
Ensembl Gene ENSMUSG00000040187
Gene Namearyl hydrocarbon receptor nuclear translocator-like 2
SynonymsMOP9, 4632430A05Rik, bHLHe6, BMAL2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location146796055-146833529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146820590 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000079373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080530] [ENSMUST00000111636] [ENSMUST00000111638] [ENSMUST00000111639] [ENSMUST00000129788]
Predicted Effect probably damaging
Transcript: ENSMUST00000080530
AA Change: S220P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079373
Gene: ENSMUSG00000040187
AA Change: S220P

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111636
AA Change: S220P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107263
Gene: ENSMUSG00000040187
AA Change: S220P

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111638
AA Change: S220P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107265
Gene: ENSMUSG00000040187
AA Change: S220P

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 1.29e-4 SMART
PAC 361 404 3.66e0 SMART
low complexity region 417 428 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111639
AA Change: S220P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107266
Gene: ENSMUSG00000040187
AA Change: S220P

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
PAS 298 364 2.7e-7 SMART
PAC 371 414 1.72e0 SMART
low complexity region 427 438 N/A INTRINSIC
low complexity region 472 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129788
SMART Domains Protein: ENSMUSP00000121170
Gene: ENSMUSG00000040187

DomainStartEndE-ValueType
HLH 54 107 6.51e-14 SMART
PAS 122 189 6.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix transcription factor belonging to the PAS (Per, Arnt, Sim) superfamily. The PAS proteins play important roles in adaptation to low atmospheric and cellular oxygen levels, exposure to certain environmental pollutants, and diurnal oscillations in light and temperature. This protein forms a transcriptionally active heterodimer with the circadian Clock protein, the structurally related Mop4, and hypoxia-inducible factors, such as Hif1alpha. Consistent with its role as a biologically relevant partner of circadian and hypoxia factors, this protein is coexpressed in regions of the brain such as the thalamus, hypothalamus, and amygdala. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Arntl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Arntl2 APN 6 146827329 splice site probably benign
IGL00481:Arntl2 APN 6 146809666 missense probably benign 0.11
IGL02141:Arntl2 APN 6 146828095 splice site probably benign
IGL02402:Arntl2 APN 6 146809768 missense possibly damaging 0.90
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0054:Arntl2 UTSW 6 146829718 missense probably benign 0.01
R0131:Arntl2 UTSW 6 146828103 missense probably benign 0.00
R0403:Arntl2 UTSW 6 146822655 missense probably damaging 1.00
R0716:Arntl2 UTSW 6 146829720 missense possibly damaging 0.82
R0799:Arntl2 UTSW 6 146823253 splice site probably benign
R0834:Arntl2 UTSW 6 146822687 missense probably damaging 1.00
R1909:Arntl2 UTSW 6 146810810 missense probably benign 0.01
R2270:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R2272:Arntl2 UTSW 6 146822114 missense probably damaging 1.00
R3715:Arntl2 UTSW 6 146822689 missense probably damaging 0.97
R4370:Arntl2 UTSW 6 146809651 missense probably damaging 1.00
R5399:Arntl2 UTSW 6 146822661 missense probably damaging 0.99
R5894:Arntl2 UTSW 6 146823234 missense possibly damaging 0.93
R5972:Arntl2 UTSW 6 146809689 missense probably damaging 0.99
R6090:Arntl2 UTSW 6 146829696 missense possibly damaging 0.90
R6111:Arntl2 UTSW 6 146820599 missense probably benign 0.16
R6279:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6300:Arntl2 UTSW 6 146821946 missense probably damaging 1.00
R6452:Arntl2 UTSW 6 146823207 missense probably benign 0.00
R6722:Arntl2 UTSW 6 146818900 missense probably damaging 0.99
R7296:Arntl2 UTSW 6 146822134 missense not run
R7335:Arntl2 UTSW 6 146809719 missense probably benign 0.01
R7481:Arntl2 UTSW 6 146818871 missense not run
R7655:Arntl2 UTSW 6 146806442 missense probably benign 0.31
R7656:Arntl2 UTSW 6 146806442 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GACCTACACTCTCTCCTCGA -3'
(R):5'- TTGCCGTGACTATGAAACTTACT -3'

Sequencing Primer
(F):5'- GAGAGCTAACAACGCTTACTGTTG -3'
(R):5'- GCCGTGACTATGAAACTTACTTTTTC -3'
Posted On2020-01-23