Incidental Mutation 'R8015:Vmn2r31'
ID617127
Institutional Source Beutler Lab
Gene Symbol Vmn2r31
Ensembl Gene ENSMUSG00000096373
Gene Namevomeronasal 2, receptor 31
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R8015 (G1)
Quality Score142.008
Status Not validated
Chromosome7
Chromosomal Location7383027-7399743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7384200 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 791 (V791I)
Ref Sequence ENSEMBL: ENSMUSP00000074613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075108]
Predicted Effect probably damaging
Transcript: ENSMUST00000075108
AA Change: V791I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074613
Gene: ENSMUSG00000096373
AA Change: V791I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 1e-33 PFAM
Pfam:NCD3G 512 565 1.4e-20 PFAM
Pfam:7tm_3 598 833 8.1e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Vmn2r31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Vmn2r31 APN 7 7396566 missense probably damaging 0.98
IGL01536:Vmn2r31 APN 7 7384848 missense probably damaging 1.00
IGL01985:Vmn2r31 APN 7 7394511 missense probably benign
IGL02116:Vmn2r31 APN 7 7394549 missense probably damaging 0.97
FR4304:Vmn2r31 UTSW 7 7384608 missense probably damaging 1.00
R1609:Vmn2r31 UTSW 7 7384889 missense probably damaging 1.00
R4647:Vmn2r31 UTSW 7 7384368 missense probably damaging 1.00
R4724:Vmn2r31 UTSW 7 7384758 missense possibly damaging 0.63
R4824:Vmn2r31 UTSW 7 7387063 critical splice donor site probably null
R5619:Vmn2r31 UTSW 7 7384530 nonsense probably null
R6225:Vmn2r31 UTSW 7 7394639 missense probably benign 0.19
R6610:Vmn2r31 UTSW 7 7384589 missense probably damaging 0.97
R6956:Vmn2r31 UTSW 7 7394506 missense probably benign
R7111:Vmn2r31 UTSW 7 7396481 missense probably damaging 0.99
R7219:Vmn2r31 UTSW 7 7387106 missense probably benign
R7219:Vmn2r31 UTSW 7 7394398 missense probably damaging 0.97
R7300:Vmn2r31 UTSW 7 7384776 missense possibly damaging 0.61
R7395:Vmn2r31 UTSW 7 7384745 missense probably damaging 1.00
R7481:Vmn2r31 UTSW 7 7384580 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCACTAGAGCAACCAGTGAGAATG -3'
(R):5'- ATGGCCACATCATCATTGTGTG -3'

Sequencing Primer
(F):5'- CAACCAGTGAGAATGAGTCTAAAAC -3'
(R):5'- TGCAACAAGGGCTCAGTTACTG -3'
Posted On2020-01-23