Mutagenetix > Incidental Mutations

Incidental Mutation 'R8015:Atp10a'

617129

Institutional Source

Beutler Lab

Gene Symbol

Atp10a

Ensembl Gene

ENSMUSG00000025324

Gene Name

ATPase, class V, type 10A

Synonyms

Atp10c, pfatp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R8015 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58656166-58829420 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 58803497 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 808 (R808L)

Ref Sequence

ENSEMBL: ENSMUSP00000129811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168747]

Predicted Effect

probably benign
Transcript: ENSMUST00000168747
AA Change: R808L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000129811
Gene: ENSMUSG00000025324
AA Change: R808L

Domain	Start	End	E-Value	Type
low complexity region	15	32	N/A	INTRINSIC
Pfam:PhoLip_ATPase_N	55	114	5.2e-23	PFAM
Pfam:E1-E2_ATPase	120	393	6.6e-10	PFAM
low complexity region	633	643	N/A	INTRINSIC
Pfam:Cation_ATPase	685	791	1.5e-7	PFAM
Pfam:HAD	697	1054	2.1e-12	PFAM
Pfam:PhoLip_ATPase_C	1071	1316	1.1e-76	PFAM
low complexity region	1458	1477	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. This gene is maternally expressed. It maps within the most common interval of deletion responsible for Angelman syndrome, also known as 'happy puppet syndrome'. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene at the distal end of the p^23DFiOD deletion may be responsible for the obesity phenotypes associated with that deletion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alad	A	G	4: 62,511,922	V121A	probably damaging	Het
Anapc2	T	A	2: 25,284,676	Y684N	probably benign	Het
Arntl2	T	C	6: 146,820,590	S220P	probably damaging	Het
Best2	A	G	8: 85,009,354	V317A	probably damaging	Het
Cacnb4	A	G	2: 52,464,643	L241P	probably damaging	Het
Col6a5	T	C	9: 105,881,741	T2089A	possibly damaging	Het
Cttnbp2	G	C	6: 18,426,093	A762G	possibly damaging	Het
Defb13	G	T	8: 21,946,812	V8F	possibly damaging	Het
Dpp6	C	T	5: 26,817,810		probably benign	Het
Fam126b	A	G	1: 58,535,482	V300A	possibly damaging	Het
Fat4	A	G	3: 38,981,916	D3239G	possibly damaging	Het
Gm16486	C	T	8: 70,716,792	S1177L	probably benign	Het
Gm5615	A	G	9: 36,534,954	V54A	probably benign	Het
Hmcn1	T	G	1: 150,598,311	R4793S	possibly damaging	Het
Hspa1a	T	A	17: 34,970,649	Q426L	probably damaging	Het
Il20rb	T	A	9: 100,474,894	Y61F	probably damaging	Het
Itgb1	T	A	8: 128,722,401	V496D	possibly damaging	Het
Jakmip1	T	C	5: 37,159,765	S102P	unknown	Het
Jmjd8	T	A	17: 25,829,328	F108I	probably damaging	Het
Krtap15	A	G	16: 88,829,209	T55A	possibly damaging	Het
Lce3d	A	T	3: 92,958,503		probably benign	Het
Lnpep	C	A	17: 17,546,499	V702F	probably damaging	Het
Lox	G	A	18: 52,528,348	A218V	probably benign	Het
Mcrs1	T	A	15: 99,248,854	K99*	probably null	Het
Mfsd8	G	A	3: 40,846,835		probably benign	Het
Msto1	G	T	3: 88,911,556	P264Q	probably damaging	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Olfr1002	G	T	2: 85,647,792	H176Q	probably damaging	Het
Olfr1368	T	C	13: 21,142,133	D308G	probably benign	Het
Pate2	A	T	9: 35,670,518	H36L	probably damaging	Het
Phf20l1	T	G	15: 66,639,948	N925K	possibly damaging	Het
Pnliprp2	G	T	19: 58,766,282	V253F	probably damaging	Het
Polr2b	A	G	5: 77,336,506	D745G	probably damaging	Het
Ptdss1	T	A	13: 66,963,343	W158R	possibly damaging	Het
Rcn3	T	A	7: 45,084,907	I226F	probably damaging	Het
Rhbdl1	C	G	17: 25,835,851	V157L	probably damaging	Het
Slc30a2	A	G	4: 134,347,450	T173A	probably benign	Het
Spata16	A	G	3: 26,667,659	T110A	probably benign	Het
Specc1l	A	G	10: 75,241,068	K53E	probably benign	Het
Speg	G	T	1: 75,415,421		probably benign	Het
Spta1	T	A	1: 174,240,171	C2055S	probably damaging	Het
Tex14	G	A	11: 87,509,600	R406Q	probably benign	Het
Tmem150b	C	T	7: 4,716,328	G198S	probably null	Het
Tnfrsf14	T	G	4: 154,926,661	Q81P	probably damaging	Het
Txndc17	A	G	11: 72,207,742	K40R	probably benign	Het
Ube3a	T	A	7: 59,284,756	V560E	probably damaging	Het
Vmn1r14	A	G	6: 57,234,030	M198V	probably damaging	Het
Vmn2r23	G	A	6: 123,704,541	S136N	probably benign	Het
Vmn2r31	C	T	7: 7,384,200	V791I	probably damaging	Het
Wdfy4	T	C	14: 33,107,747	Y984C		Het
Zfp386	T	G	12: 116,059,407	D248E	probably damaging	Het

Other mutations in Atp10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Atp10a	APN	7	58794482	missense	probably benign	0.06
IGL00973:Atp10a	APN	7	58807470	missense	probably damaging	1.00
IGL00984:Atp10a	APN	7	58658741	missense	probably damaging	1.00
IGL01086:Atp10a	APN	7	58824318	missense	probably damaging	0.96
IGL01296:Atp10a	APN	7	58813625	missense	probably benign	0.02
IGL01731:Atp10a	APN	7	58797562	missense	probably benign	0.16
IGL02081:Atp10a	APN	7	58827856	missense	possibly damaging	0.62
IGL02095:Atp10a	APN	7	58807393	missense	probably damaging	1.00
IGL02549:Atp10a	APN	7	58819733	missense	probably benign	0.00
IGL02558:Atp10a	APN	7	58819642	missense	probably damaging	0.98
IGL02659:Atp10a	APN	7	58813631	missense	probably benign
IGL02986:Atp10a	APN	7	58828721	missense	probably benign
IGL03218:Atp10a	APN	7	58788448	critical splice donor site	probably null
PIT4260001:Atp10a	UTSW	7	58791118	nonsense	probably null
PIT4445001:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
PIT4810001:Atp10a	UTSW	7	58813848	missense	probably damaging	0.99
R0091:Atp10a	UTSW	7	58774046	splice site	probably benign
R0349:Atp10a	UTSW	7	58803467	missense	probably damaging	0.98
R0426:Atp10a	UTSW	7	58784734	missense	probably benign	0.00
R0609:Atp10a	UTSW	7	58819740	splice site	probably null
R0722:Atp10a	UTSW	7	58816183	missense	possibly damaging	0.75
R0741:Atp10a	UTSW	7	58828589	missense	possibly damaging	0.90
R1172:Atp10a	UTSW	7	58803766	missense	probably benign	0.05
R1342:Atp10a	UTSW	7	58816146	splice site	probably benign
R1648:Atp10a	UTSW	7	58784827	missense	probably damaging	1.00
R1715:Atp10a	UTSW	7	58786505	missense	probably damaging	0.98
R1737:Atp10a	UTSW	7	58827238	splice site	probably benign
R1799:Atp10a	UTSW	7	58824434	missense	probably damaging	1.00
R1909:Atp10a	UTSW	7	58828712	missense	probably benign	0.12
R1918:Atp10a	UTSW	7	58827935	missense	possibly damaging	0.82
R2031:Atp10a	UTSW	7	58827930	nonsense	probably null
R2080:Atp10a	UTSW	7	58824327	missense	probably damaging	0.97
R2424:Atp10a	UTSW	7	58794555	missense	probably benign	0.16
R2696:Atp10a	UTSW	7	58813618	missense	probably benign	0.00
R3932:Atp10a	UTSW	7	58827104	missense	possibly damaging	0.69
R4198:Atp10a	UTSW	7	58813686	missense	probably damaging	1.00
R4453:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4632:Atp10a	UTSW	7	58807438	missense	possibly damaging	0.48
R4661:Atp10a	UTSW	7	58658500	small deletion	probably benign
R4782:Atp10a	UTSW	7	58791095	missense	probably benign
R4888:Atp10a	UTSW	7	58785307	missense	probably damaging	1.00
R4935:Atp10a	UTSW	7	58813764	missense	probably damaging	1.00
R5051:Atp10a	UTSW	7	58740246	frame shift	probably null
R5213:Atp10a	UTSW	7	58773983	missense	probably damaging	0.99
R5617:Atp10a	UTSW	7	58803675	missense	probably benign	0.06
R5834:Atp10a	UTSW	7	58658618	missense	probably benign	0.01
R5885:Atp10a	UTSW	7	58813800	missense	possibly damaging	0.92
R6013:Atp10a	UTSW	7	58797790	missense	probably benign	0.05
R6136:Atp10a	UTSW	7	58828340	missense	probably benign
R6269:Atp10a	UTSW	7	58803739	missense	possibly damaging	0.51
R6380:Atp10a	UTSW	7	58819684	nonsense	probably null
R6743:Atp10a	UTSW	7	58797814	missense	possibly damaging	0.89
R6875:Atp10a	UTSW	7	58797352	missense	probably benign	0.01
R6975:Atp10a	UTSW	7	58773985	missense	probably damaging	1.00
R7082:Atp10a	UTSW	7	58658819	missense	probably damaging	1.00
R7203:Atp10a	UTSW	7	58786473	missense	probably benign
R7224:Atp10a	UTSW	7	58797471	missense	probably benign	0.00
R7287:Atp10a	UTSW	7	58827269	missense	probably damaging	1.00
R7437:Atp10a	UTSW	7	58658540	missense	unknown
R7474:Atp10a	UTSW	7	58658527	missense	unknown
R7530:Atp10a	UTSW	7	58773976	missense	probably benign	0.02
R7561:Atp10a	UTSW	7	58827133	missense	probably damaging	0.98
R7743:Atp10a	UTSW	7	58803709	missense	probably damaging	1.00
R7767:Atp10a	UTSW	7	58658849	missense	probably damaging	1.00
R7861:Atp10a	UTSW	7	58788359	missense	probably damaging	1.00
R7903:Atp10a	UTSW	7	58658822	missense	probably damaging	1.00
R8166:Atp10a	UTSW	7	58807522	missense	possibly damaging	0.46
R8201:Atp10a	UTSW	7	58819676	nonsense	probably null
R8465:Atp10a	UTSW	7	58828310	missense	probably benign	0.32
Z1176:Atp10a	UTSW	7	58788447	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCCTTATTAAAGTAACAGCTGGC -3'
(R):5'- AGGTGCAAGTTCGTCTCCAG -3'

Sequencing Primer
(F):5'- AAGTAACAGCTGGCTGATTTTGAGC -3'
(R):5'- CTTTGCTCAGAACCTATGGAGAC -3'

Posted On

2020-01-23