Incidental Mutation 'R8015:Itgb1'
ID617134
Institutional Source Beutler Lab
Gene Symbol Itgb1
Ensembl Gene ENSMUSG00000025809
Gene Nameintegrin beta 1 (fibronectin receptor beta)
SynonymsGm9863, Fnrb, CD29, 4633401G24Rik, beta1 integrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8015 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location128685654-128733200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128722401 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 496 (V496D)
Ref Sequence ENSEMBL: ENSMUSP00000087457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090006] [ENSMUST00000124826]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090006
AA Change: V496D

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087457
Gene: ENSMUSG00000025809
AA Change: V496D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PSI 26 76 3.01e-7 SMART
INB 34 464 2e-298 SMART
VWA 142 372 1.45e0 SMART
low complexity region 568 581 N/A INTRINSIC
Pfam:EGF_2 599 630 8.8e-8 PFAM
Integrin_B_tail 640 728 4.58e-37 SMART
transmembrane domain 729 751 N/A INTRINSIC
Integrin_b_cyt 752 798 3.43e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124826
SMART Domains Protein: ENSMUSP00000120026
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3VI4|D 21 51 2e-16 PDB
Blast:PSI 26 51 1e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149116
SMART Domains Protein: ENSMUSP00000119699
Gene: ENSMUSG00000025809

DomainStartEndE-ValueType
Pfam:Integrin_B_tail 1 39 1.9e-12 PFAM
transmembrane domain 40 62 N/A INTRINSIC
Integrin_b_cyt 63 109 8.77e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric proteins made up of alpha and beta subunits. At least 18 alpha and 8 beta subunits have been described in mammals. Integrin family members are membrane receptors involved in cell adhesion and recognition in a variety of processes including embryogenesis, hemostasis, tissue repair, immune response and metastatic diffusion of tumor cells. This gene encodes a beta subunit. Multiple alternatively spliced transcript variants which encode different protein isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants die at or soon after implantation. Tissue-specific knockouts exhibit skin blisters, hair-loss, brain and heart defects, and impaired immune responses, wound healing, and hematopoietic stem cell migration, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Dpp6 C T 5: 26,817,810 probably benign Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lce3d A T 3: 92,958,503 probably benign Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Speg G T 1: 75,415,421 probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Itgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Itgb1 APN 8 128713918 splice site probably benign
IGL01407:Itgb1 APN 8 128722834 missense probably benign 0.08
IGL03025:Itgb1 APN 8 128722584 missense possibly damaging 0.96
Drystacked UTSW 8 128732054 missense possibly damaging 0.79
Jumble UTSW 8 128714116 missense probably damaging 1.00
PIT4377001:Itgb1 UTSW 8 128710383 missense probably damaging 1.00
R0136:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0244:Itgb1 UTSW 8 128717685 splice site probably benign
R0483:Itgb1 UTSW 8 128726167 missense possibly damaging 0.79
R0606:Itgb1 UTSW 8 128722372 unclassified probably benign
R0657:Itgb1 UTSW 8 128722854 missense possibly damaging 0.96
R0865:Itgb1 UTSW 8 128710251 critical splice acceptor site probably null
R1052:Itgb1 UTSW 8 128713305 missense probably damaging 1.00
R1429:Itgb1 UTSW 8 128717676 critical splice donor site probably null
R1589:Itgb1 UTSW 8 128705458 missense probably damaging 0.99
R1589:Itgb1 UTSW 8 128705459 missense possibly damaging 0.95
R1614:Itgb1 UTSW 8 128720065 missense probably damaging 1.00
R1672:Itgb1 UTSW 8 128732045 missense probably damaging 1.00
R1723:Itgb1 UTSW 8 128726038 missense probably damaging 0.98
R1865:Itgb1 UTSW 8 128720457 missense probably benign 0.01
R3786:Itgb1 UTSW 8 128713358 missense probably damaging 1.00
R4223:Itgb1 UTSW 8 128714143 missense probably damaging 1.00
R4756:Itgb1 UTSW 8 128717222 missense probably damaging 0.98
R4826:Itgb1 UTSW 8 128720308 missense probably damaging 1.00
R4880:Itgb1 UTSW 8 128716150 missense probably damaging 1.00
R5202:Itgb1 UTSW 8 128720010 missense probably damaging 0.99
R5682:Itgb1 UTSW 8 128727068 splice site probably null
R5935:Itgb1 UTSW 8 128713237 nonsense probably null
R6156:Itgb1 UTSW 8 128732054 missense possibly damaging 0.79
R6160:Itgb1 UTSW 8 128720283 missense possibly damaging 0.95
R6248:Itgb1 UTSW 8 128722421 missense possibly damaging 0.80
R6812:Itgb1 UTSW 8 128705410 splice site probably null
R6869:Itgb1 UTSW 8 128720035 missense probably benign 0.01
R7249:Itgb1 UTSW 8 128720404 missense probably benign 0.28
R7496:Itgb1 UTSW 8 128720305 missense probably benign
R7679:Itgb1 UTSW 8 128720448 missense probably damaging 0.99
R7787:Itgb1 UTSW 8 128727018 missense probably benign 0.32
R7800:Itgb1 UTSW 8 128713237 missense possibly damaging 0.89
R8687:Itgb1 UTSW 8 128716216 missense probably damaging 1.00
R8709:Itgb1 UTSW 8 128713406 intron probably benign
Z1088:Itgb1 UTSW 8 128713369 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTAAATTTTCCCCAAGGCTC -3'
(R):5'- GTTGAAGTTATCACACTCGCAG -3'

Sequencing Primer
(F):5'- CCAAGGCTCCTGTATGTTCTATAAG -3'
(R):5'- CACTCGCAGAATTTTCCAGAG -3'
Posted On2020-01-23