Incidental Mutation 'R8015:Olfr1368'
ID617143
Institutional Source Beutler Lab
Gene Symbol Olfr1368
Ensembl Gene ENSMUSG00000045474
Gene Nameolfactory receptor 1368
SynonymsMOR256-15, GA_x6K02T2QHY8-12104556-12105500
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location21141882-21145867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21142133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 308 (D308G)
Ref Sequence ENSEMBL: ENSMUSP00000149549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055298] [ENSMUST00000216039]
Predicted Effect probably benign
Transcript: ENSMUST00000055298
AA Change: D308G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050942
Gene: ENSMUSG00000045474
AA Change: D308G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.8e-49 PFAM
Pfam:7tm_1 41 290 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216039
AA Change: D308G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Olfr1368
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03354:Olfr1368 APN 13 21142484 missense probably damaging 1.00
IGL03385:Olfr1368 APN 13 21142487 missense probably benign 0.01
R0137:Olfr1368 UTSW 13 21142166 missense possibly damaging 0.86
R1168:Olfr1368 UTSW 13 21142617 missense probably benign 0.04
R1212:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1214:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1237:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1238:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1239:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1280:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1309:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1436:Olfr1368 UTSW 13 21142992 missense probably benign 0.01
R1443:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1444:Olfr1368 UTSW 13 21142167 missense probably benign 0.16
R1602:Olfr1368 UTSW 13 21142650 missense probably damaging 0.99
R1627:Olfr1368 UTSW 13 21142955 missense probably damaging 0.99
R1649:Olfr1368 UTSW 13 21142742 missense probably damaging 1.00
R1781:Olfr1368 UTSW 13 21142764 missense probably benign 0.08
R1858:Olfr1368 UTSW 13 21142394 missense probably damaging 1.00
R2520:Olfr1368 UTSW 13 21142576 nonsense probably null
R4873:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R4875:Olfr1368 UTSW 13 21142280 missense probably damaging 1.00
R5009:Olfr1368 UTSW 13 21142265 missense probably benign 0.01
R6222:Olfr1368 UTSW 13 21142877 missense probably damaging 1.00
R7031:Olfr1368 UTSW 13 21143000 missense probably benign
R7126:Olfr1368 UTSW 13 21142718 missense probably damaging 1.00
R7691:Olfr1368 UTSW 13 21142970 missense probably benign
R7875:Olfr1368 UTSW 13 21142923 missense probably damaging 1.00
R7958:Olfr1368 UTSW 13 21142923 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTGATAGCTACTCCCTCCTG -3'
(R):5'- CCTCAATACATGTGGCTCCC -3'

Sequencing Primer
(F):5'- TGAAGCAACTGACTGCATTGC -3'
(R):5'- CTCACAGTTGTAACACTGTTTTACGG -3'
Posted On2020-01-23