Incidental Mutation 'R8015:Jmjd8'
ID617150
Institutional Source Beutler Lab
Gene Symbol Jmjd8
Ensembl Gene ENSMUSG00000025736
Gene Namejumonji domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25828867-25831842 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25829328 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 108 (F108I)
Ref Sequence ENSEMBL: ENSMUSP00000122744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000123582] [ENSMUST00000133595]
Predicted Effect probably damaging
Transcript: ENSMUST00000026832
AA Change: F63I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736
AA Change: F63I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123582
AA Change: F45I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736
AA Change: F45I

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133595
AA Change: F108I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736
AA Change: F108I

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736
AA Change: F61I

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced capillaries in muscle tissue and reduced glycolysis in isolated cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Jmjd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01087:Jmjd8 APN 17 25829171 splice site probably benign
IGL01813:Jmjd8 APN 17 25829238 critical splice acceptor site probably null
IGL02858:Jmjd8 APN 17 25830160 missense probably damaging 1.00
IGL03326:Jmjd8 APN 17 25829165 critical splice donor site probably null
R0045:Jmjd8 UTSW 17 25829281 missense probably damaging 1.00
R1491:Jmjd8 UTSW 17 25829292 missense possibly damaging 0.66
R4276:Jmjd8 UTSW 17 25829813 unclassified probably benign
R4277:Jmjd8 UTSW 17 25829813 unclassified probably benign
R4279:Jmjd8 UTSW 17 25829813 unclassified probably benign
R4534:Jmjd8 UTSW 17 25829010 unclassified probably null
R6490:Jmjd8 UTSW 17 25829112 missense probably benign 0.08
R6904:Jmjd8 UTSW 17 25829052 missense possibly damaging 0.90
R7305:Jmjd8 UTSW 17 25830327 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATGGTGACTGTGATTCTGCC -3'
(R):5'- TGTCCGTGAGTCCTTGCAAG -3'

Sequencing Primer
(F):5'- GTGATTCTGCCTGCCTCTGG -3'
(R):5'- TCCGTGAGTCCTTGCAAGATGAC -3'
Posted On2020-01-23