Incidental Mutation 'R8015:Rhbdl1'
ID617151
Institutional Source Beutler Lab
Gene Symbol Rhbdl1
Ensembl Gene ENSMUSG00000025735
Gene Namerhomboid like 1
SynonymsRhbdl
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25834465-25837295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 25835851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 157 (V157L)
Ref Sequence ENSEMBL: ENSMUSP00000026831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000026832] [ENSMUST00000043897] [ENSMUST00000044911] [ENSMUST00000133595] [ENSMUST00000183929] [ENSMUST00000184865]
Predicted Effect probably damaging
Transcript: ENSMUST00000026831
AA Change: V157L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735
AA Change: V157L

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably benign
Transcript: ENSMUST00000183929
AA Change: V161L

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735
AA Change: V161L

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184865
AA Change: V103L

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to Rhomboid in Drosophila which is involved in signalling in the Spitz/epidermal growth factor receptor/mitogen-activated protein kinase pathway. The Rhomboid family of proteins consists of intramembrane serine proteases containing several transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Pnliprp2 G T 19: 58,766,282 V253F probably damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Rhbdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Rhbdl1 APN 17 25836138 missense possibly damaging 0.62
R1672:Rhbdl1 UTSW 17 25836409 critical splice donor site probably null
R1922:Rhbdl1 UTSW 17 25835539 missense probably damaging 1.00
R4976:Rhbdl1 UTSW 17 25835028 nonsense probably null
R5500:Rhbdl1 UTSW 17 25836554 missense possibly damaging 0.83
R6293:Rhbdl1 UTSW 17 25834969 missense probably damaging 1.00
R6296:Rhbdl1 UTSW 17 25834969 missense probably damaging 1.00
R6535:Rhbdl1 UTSW 17 25835825 nonsense probably null
R6848:Rhbdl1 UTSW 17 25836184 nonsense probably null
R7619:Rhbdl1 UTSW 17 25837017 missense possibly damaging 0.85
R7721:Rhbdl1 UTSW 17 25836149 missense probably benign 0.10
R7746:Rhbdl1 UTSW 17 25836193 missense probably benign 0.06
X0009:Rhbdl1 UTSW 17 25836409 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGCCTTCAGAGTCAGTGGGC -3'
(R):5'- ATGTGGCCTACGAGATCCTG -3'

Sequencing Primer
(F):5'- CTTCAGAGTCAGTGGGCAGGTG -3'
(R):5'- TGGTACTTCTACAGGCACCG -3'
Posted On2020-01-23