Incidental Mutation 'R8015:Pnliprp2'
ID617154
Institutional Source Beutler Lab
Gene Symbol Pnliprp2
Ensembl Gene ENSMUSG00000025091
Gene Namepancreatic lipase-related protein 2
SynonymsPLRP2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R8015 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location58759723-58777533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58766282 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 253 (V253F)
Ref Sequence ENSEMBL: ENSMUSP00000026081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026081]
Predicted Effect probably damaging
Transcript: ENSMUST00000026081
AA Change: V253F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026081
Gene: ENSMUSG00000025091
AA Change: V253F

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Lipase 31 367 4.1e-166 PFAM
LH2 370 482 7.49e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lipase that hydrolyzes galactolipids, the main components of plant membrane lipids. An allelic polymorphism in this gene results in both coding and non-coding variants; the reference genome represents the non-coding allele. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display deficient lipid absorbtion before weaning which results in growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alad A G 4: 62,511,922 V121A probably damaging Het
Anapc2 T A 2: 25,284,676 Y684N probably benign Het
Arntl2 T C 6: 146,820,590 S220P probably damaging Het
Atp10a G T 7: 58,803,497 R808L probably benign Het
Best2 A G 8: 85,009,354 V317A probably damaging Het
Cacnb4 A G 2: 52,464,643 L241P probably damaging Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Defb13 G T 8: 21,946,812 V8F possibly damaging Het
Fam126b A G 1: 58,535,482 V300A possibly damaging Het
Fat4 A G 3: 38,981,916 D3239G possibly damaging Het
Gm16486 C T 8: 70,716,792 S1177L probably benign Het
Gm5615 A G 9: 36,534,954 V54A probably benign Het
Hmcn1 T G 1: 150,598,311 R4793S possibly damaging Het
Hspa1a T A 17: 34,970,649 Q426L probably damaging Het
Il20rb T A 9: 100,474,894 Y61F probably damaging Het
Itgb1 T A 8: 128,722,401 V496D possibly damaging Het
Jakmip1 T C 5: 37,159,765 S102P unknown Het
Jmjd8 T A 17: 25,829,328 F108I probably damaging Het
Krtap15 A G 16: 88,829,209 T55A possibly damaging Het
Lnpep C A 17: 17,546,499 V702F probably damaging Het
Lox G A 18: 52,528,348 A218V probably benign Het
Mcrs1 T A 15: 99,248,854 K99* probably null Het
Mfsd8 G A 3: 40,846,835 probably benign Het
Msto1 G T 3: 88,911,556 P264Q probably damaging Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Olfr1002 G T 2: 85,647,792 H176Q probably damaging Het
Olfr1368 T C 13: 21,142,133 D308G probably benign Het
Pate2 A T 9: 35,670,518 H36L probably damaging Het
Phf20l1 T G 15: 66,639,948 N925K possibly damaging Het
Polr2b A G 5: 77,336,506 D745G probably damaging Het
Ptdss1 T A 13: 66,963,343 W158R possibly damaging Het
Rcn3 T A 7: 45,084,907 I226F probably damaging Het
Rhbdl1 C G 17: 25,835,851 V157L probably damaging Het
Slc30a2 A G 4: 134,347,450 T173A probably benign Het
Spata16 A G 3: 26,667,659 T110A probably benign Het
Specc1l A G 10: 75,241,068 K53E probably benign Het
Spta1 T A 1: 174,240,171 C2055S probably damaging Het
Tex14 G A 11: 87,509,600 R406Q probably benign Het
Tmem150b C T 7: 4,716,328 G198S probably null Het
Tnfrsf14 T G 4: 154,926,661 Q81P probably damaging Het
Txndc17 A G 11: 72,207,742 K40R probably benign Het
Ube3a T A 7: 59,284,756 V560E probably damaging Het
Vmn1r14 A G 6: 57,234,030 M198V probably damaging Het
Vmn2r23 G A 6: 123,704,541 S136N probably benign Het
Vmn2r31 C T 7: 7,384,200 V791I probably damaging Het
Wdfy4 T C 14: 33,107,747 Y984C Het
Zfp386 T G 12: 116,059,407 D248E probably damaging Het
Other mutations in Pnliprp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Pnliprp2 APN 19 58760497 missense probably benign
IGL02739:Pnliprp2 APN 19 58760509 critical splice donor site probably null
IGL02881:Pnliprp2 APN 19 58771446 missense probably benign 0.01
IGL03411:Pnliprp2 APN 19 58760415 missense probably benign
R0140:Pnliprp2 UTSW 19 58766363 missense probably benign 0.00
R0558:Pnliprp2 UTSW 19 58774087 missense probably benign 0.00
R1873:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1874:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R1875:Pnliprp2 UTSW 19 58763389 missense probably benign 0.00
R2382:Pnliprp2 UTSW 19 58768630 missense probably benign 0.00
R3893:Pnliprp2 UTSW 19 58766273 missense probably benign 0.19
R3915:Pnliprp2 UTSW 19 58760362 missense probably damaging 1.00
R4620:Pnliprp2 UTSW 19 58762286 missense possibly damaging 0.67
R4893:Pnliprp2 UTSW 19 58771421 missense probably benign 0.08
R4957:Pnliprp2 UTSW 19 58775145 missense possibly damaging 0.72
R4959:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R4973:Pnliprp2 UTSW 19 58766318 missense probably benign 0.16
R5346:Pnliprp2 UTSW 19 58759800 missense probably benign
R6049:Pnliprp2 UTSW 19 58760452 missense possibly damaging 0.77
R6228:Pnliprp2 UTSW 19 58763442 critical splice donor site probably null
R6394:Pnliprp2 UTSW 19 58761598 missense probably benign
R6829:Pnliprp2 UTSW 19 58759873 missense probably benign
R7235:Pnliprp2 UTSW 19 58775227 missense probably benign 0.03
R7534:Pnliprp2 UTSW 19 58775142 missense probably benign
R7834:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
R7917:Pnliprp2 UTSW 19 58774159 missense probably benign 0.25
X0058:Pnliprp2 UTSW 19 58774142 missense possibly damaging 0.59
Z1088:Pnliprp2 UTSW 19 58762325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTGCCCATCTCTGAGAAC -3'
(R):5'- TGGCCAGACTCTCATGCTAC -3'

Sequencing Primer
(F):5'- CTCTCTGCAAAAAGAGCTGGTGTG -3'
(R):5'- GCCAGACTCTCATGCTACACTCTG -3'
Posted On2020-01-23