Incidental Mutation 'R8016:Crb2'
ID617157
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8016 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37786556 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 183 (A183E)
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050372
AA Change: A183E

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: A183E

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147600
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,364,952 M105K probably benign Het
Acer2 T C 4: 86,886,206 F53L probably damaging Het
Adam15 A G 3: 89,345,361 V307A probably benign Het
Afmid A G 11: 117,835,544 I193V probably benign Het
Ahdc1 C T 4: 133,062,915 T489M possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Bag6 T A 17: 35,138,757 V133D unknown Het
Btla T C 16: 45,250,587 V304A probably damaging Het
Cacna1g A T 11: 94,443,181 I878N probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Clcnka A T 4: 141,390,152 S445T possibly damaging Het
Col6a6 A G 9: 105,767,528 V1187A possibly damaging Het
Col7a1 T C 9: 108,958,644 V664A unknown Het
Cyp2j5 C T 4: 96,658,714 V188I probably damaging Het
D430041D05Rik A T 2: 104,192,519 N1043K probably damaging Het
Dnah14 G A 1: 181,648,311 R1376H probably benign Het
Foxj1 A G 11: 116,331,849 F376S probably damaging Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Hsd17b11 A T 5: 104,021,660 I27N probably damaging Het
Itih1 A G 14: 30,935,294 V528A probably damaging Het
Ndor1 A G 2: 25,249,317 V283A probably benign Het
Nup54 G A 5: 92,434,317 T45I unknown Het
Olfr1186 G A 2: 88,526,173 V197I probably damaging Het
Olfr828 T C 9: 18,816,292 M1V probably null Het
Pbld2 T C 10: 63,047,965 F70L probably damaging Het
Pdzph1 A G 17: 58,932,481 S951P probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Rasgrp1 A T 2: 117,287,833 C558* probably null Het
Slc12a6 A T 2: 112,356,554 H966L probably benign Het
Snx14 A T 9: 88,415,687 V176D probably damaging Het
St6galnac3 G T 3: 153,205,492 H277Q probably damaging Het
Syde2 T A 3: 146,001,972 D822E possibly damaging Het
Syne2 A T 12: 75,942,907 E1853D probably benign Het
Tigd4 T C 3: 84,594,664 V296A possibly damaging Het
Tmed4 A T 11: 6,274,242 probably benign Het
Trmt6 A T 2: 132,809,906 I198N probably damaging Het
Ubap2 A G 4: 41,195,201 S1117P possibly damaging Het
Wasl A T 6: 24,634,595 Y103N probably damaging Het
Zfp628 A G 7: 4,919,229 D150G probably damaging Het
Zfp936 T A 7: 43,189,424 V105D possibly damaging Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R7819:Crb2 UTSW 2 37791591 missense probably benign 0.00
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CATATGGGTAACTGGAGCAGAC -3'
(R):5'- CTTGTGTGCCAGGTACATCG -3'

Sequencing Primer
(F):5'- TAACTGGAGCAGACTGGGGC -3'
(R):5'- AACCCTGTTTGCAGATCAGG -3'
Posted On2020-01-23