Incidental Mutation 'R8016:Olfr1186'
ID617158
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R8016 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88526173 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 197 (V197I)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000121619
AA Change: V197I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000215912
AA Change: V197I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000216978
AA Change: V197I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,364,952 M105K probably benign Het
Acer2 T C 4: 86,886,206 F53L probably damaging Het
Adam15 A G 3: 89,345,361 V307A probably benign Het
Afmid A G 11: 117,835,544 I193V probably benign Het
Ahdc1 C T 4: 133,062,915 T489M possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Bag6 T A 17: 35,138,757 V133D unknown Het
Btla T C 16: 45,250,587 V304A probably damaging Het
Cacna1g A T 11: 94,443,181 I878N probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Clcnka A T 4: 141,390,152 S445T possibly damaging Het
Col6a6 A G 9: 105,767,528 V1187A possibly damaging Het
Col7a1 T C 9: 108,958,644 V664A unknown Het
Crb2 C A 2: 37,786,556 A183E possibly damaging Het
Cyp2j5 C T 4: 96,658,714 V188I probably damaging Het
D430041D05Rik A T 2: 104,192,519 N1043K probably damaging Het
Dnah14 G A 1: 181,648,311 R1376H probably benign Het
Foxj1 A G 11: 116,331,849 F376S probably damaging Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Hsd17b11 A T 5: 104,021,660 I27N probably damaging Het
Itih1 A G 14: 30,935,294 V528A probably damaging Het
Ndor1 A G 2: 25,249,317 V283A probably benign Het
Nup54 G A 5: 92,434,317 T45I unknown Het
Olfr828 T C 9: 18,816,292 M1V probably null Het
Pbld2 T C 10: 63,047,965 F70L probably damaging Het
Pdzph1 A G 17: 58,932,481 S951P probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Rasgrp1 A T 2: 117,287,833 C558* probably null Het
Slc12a6 A T 2: 112,356,554 H966L probably benign Het
Snx14 A T 9: 88,415,687 V176D probably damaging Het
St6galnac3 G T 3: 153,205,492 H277Q probably damaging Het
Syde2 T A 3: 146,001,972 D822E possibly damaging Het
Syne2 A T 12: 75,942,907 E1853D probably benign Het
Tigd4 T C 3: 84,594,664 V296A possibly damaging Het
Tmed4 A T 11: 6,274,242 probably benign Het
Trmt6 A T 2: 132,809,906 I198N probably damaging Het
Ubap2 A G 4: 41,195,201 S1117P possibly damaging Het
Wasl A T 6: 24,634,595 Y103N probably damaging Het
Zfp628 A G 7: 4,919,229 D150G probably damaging Het
Zfp936 T A 7: 43,189,424 V105D possibly damaging Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
R7891:Olfr1186 UTSW 2 88525945 missense probably benign 0.04
R7951:Olfr1186 UTSW 2 88525804 missense probably damaging 0.98
R7978:Olfr1186 UTSW 2 88525670 nonsense probably null
R8039:Olfr1186 UTSW 2 88525871 missense probably benign 0.07
R8389:Olfr1186 UTSW 2 88525587 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GCCTTTGACCGCTATGTAGC -3'
(R):5'- AAAAGTGGTTGGTGGCCATG -3'

Sequencing Primer
(F):5'- ATGAGCCAACATATCTGTGGTG -3'
(R):5'- AGACAAGGCCTTTCGTCT -3'
Posted On2020-01-23