Incidental Mutation 'R8016:Trmt6'
ID617162
Institutional Source Beutler Lab
Gene Symbol Trmt6
Ensembl Gene ENSMUSG00000037376
Gene NametRNA methyltransferase 6
Synonyms3300001M20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R8016 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132804207-132816055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132809906 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 198 (I198N)
Ref Sequence ENSEMBL: ENSMUSP00000044687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039554]
Predicted Effect probably damaging
Transcript: ENSMUST00000039554
AA Change: I198N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044687
Gene: ENSMUSG00000037376
AA Change: I198N

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Gcd10p 20 302 7.2e-74 PFAM
coiled coil region 345 364 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tRNA methyltransferase 6 protein family. A similar protein in yeast is part of a two component methyltransferase, which is involved in the posttranslational modification that produces the modified nucleoside 1-methyladenosine in tRNAs. Modified 1-methyladenosine influences initiator methionine stability and may be involved in the replication of human immunodeficiency virus type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,364,952 M105K probably benign Het
Acer2 T C 4: 86,886,206 F53L probably damaging Het
Adam15 A G 3: 89,345,361 V307A probably benign Het
Afmid A G 11: 117,835,544 I193V probably benign Het
Ahdc1 C T 4: 133,062,915 T489M possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Bag6 T A 17: 35,138,757 V133D unknown Het
Btla T C 16: 45,250,587 V304A probably damaging Het
Cacna1g A T 11: 94,443,181 I878N probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Clcnka A T 4: 141,390,152 S445T possibly damaging Het
Clspn AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 4: 126,573,314 probably benign Het
Col6a6 A G 9: 105,767,528 V1187A possibly damaging Het
Col7a1 T C 9: 108,958,644 V664A unknown Het
Crb2 C A 2: 37,786,556 A183E possibly damaging Het
Cyp2j5 C T 4: 96,658,714 V188I probably damaging Het
D430041D05Rik A T 2: 104,192,519 N1043K probably damaging Het
Dnah14 G A 1: 181,648,311 R1376H probably benign Het
Foxj1 A G 11: 116,331,849 F376S probably damaging Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Hsd17b11 A T 5: 104,021,660 I27N probably damaging Het
Itih1 A G 14: 30,935,294 V528A probably damaging Het
Ndor1 A G 2: 25,249,317 V283A probably benign Het
Nup54 G A 5: 92,434,317 T45I unknown Het
Olfr1186 G A 2: 88,526,173 V197I probably damaging Het
Olfr828 T C 9: 18,816,292 M1V probably null Het
Pbld2 T C 10: 63,047,965 F70L probably damaging Het
Pdzph1 A G 17: 58,932,481 S951P probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Rasgrp1 A T 2: 117,287,833 C558* probably null Het
Slc12a6 A T 2: 112,356,554 H966L probably benign Het
Snx14 A T 9: 88,415,687 V176D probably damaging Het
St6galnac3 G T 3: 153,205,492 H277Q probably damaging Het
Syde2 T A 3: 146,001,972 D822E possibly damaging Het
Syne2 A T 12: 75,942,907 E1853D probably benign Het
Tigd4 T C 3: 84,594,664 V296A possibly damaging Het
Ubap2 A G 4: 41,195,201 S1117P possibly damaging Het
Wasl A T 6: 24,634,595 Y103N probably damaging Het
Zfp628 A G 7: 4,919,229 D150G probably damaging Het
Zfp936 T A 7: 43,189,424 V105D possibly damaging Het
Other mutations in Trmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Trmt6 APN 2 132805458 missense probably benign 0.01
IGL02604:Trmt6 APN 2 132810437 nonsense probably null
IGL03216:Trmt6 APN 2 132808698 missense probably null
IGL03231:Trmt6 APN 2 132815836 missense probably benign 0.01
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0086:Trmt6 UTSW 2 132809017 critical splice acceptor site probably benign
R0485:Trmt6 UTSW 2 132809030 splice site probably benign
R0827:Trmt6 UTSW 2 132815834 missense probably damaging 1.00
R1654:Trmt6 UTSW 2 132815835 missense possibly damaging 0.92
R1757:Trmt6 UTSW 2 132810237 missense probably damaging 0.96
R1974:Trmt6 UTSW 2 132811048 missense probably damaging 1.00
R2008:Trmt6 UTSW 2 132806909 nonsense probably null
R2310:Trmt6 UTSW 2 132808912 missense probably damaging 1.00
R4989:Trmt6 UTSW 2 132808271 missense possibly damaging 0.58
R5288:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5385:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5386:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R6546:Trmt6 UTSW 2 132812153 missense probably benign 0.16
R6815:Trmt6 UTSW 2 132809858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTATTCTTAAAGCAACTCGATC -3'
(R):5'- AGCTTGCTCACCTGCATAAAG -3'

Sequencing Primer
(F):5'- AAAGCAACTCGATCTGGTTCTC -3'
(R):5'- AAATTGTAAGTCCTTTTACTGTCGCC -3'
Posted On2020-01-23