Incidental Mutation 'R8016:Ubap2'
ID617167
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R8016 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41195201 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1117 (S1117P)
Ref Sequence ENSEMBL: ENSMUSP00000030143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000040008] [ENSMUST00000108068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030143
AA Change: S1117P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: S1117P

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040008
SMART Domains Protein: ENSMUSP00000038813
Gene: ENSMUSG00000036241

DomainStartEndE-ValueType
UBCc 11 174 1.55e-65 SMART
low complexity region 204 232 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108068
AA Change: S1116P

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: S1116P

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000120205
Gene: ENSMUSG00000028433
AA Change: S137P

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
low complexity region 49 70 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 117 136 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,364,952 M105K probably benign Het
Acer2 T C 4: 86,886,206 F53L probably damaging Het
Adam15 A G 3: 89,345,361 V307A probably benign Het
Afmid A G 11: 117,835,544 I193V probably benign Het
Ahdc1 C T 4: 133,062,915 T489M possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Bag6 T A 17: 35,138,757 V133D unknown Het
Btla T C 16: 45,250,587 V304A probably damaging Het
Cacna1g A T 11: 94,443,181 I878N probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Clcnka A T 4: 141,390,152 S445T possibly damaging Het
Col6a6 A G 9: 105,767,528 V1187A possibly damaging Het
Col7a1 T C 9: 108,958,644 V664A unknown Het
Crb2 C A 2: 37,786,556 A183E possibly damaging Het
Cyp2j5 C T 4: 96,658,714 V188I probably damaging Het
D430041D05Rik A T 2: 104,192,519 N1043K probably damaging Het
Dnah14 G A 1: 181,648,311 R1376H probably benign Het
Foxj1 A G 11: 116,331,849 F376S probably damaging Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Hsd17b11 A T 5: 104,021,660 I27N probably damaging Het
Itih1 A G 14: 30,935,294 V528A probably damaging Het
Ndor1 A G 2: 25,249,317 V283A probably benign Het
Nup54 G A 5: 92,434,317 T45I unknown Het
Olfr1186 G A 2: 88,526,173 V197I probably damaging Het
Olfr828 T C 9: 18,816,292 M1V probably null Het
Pbld2 T C 10: 63,047,965 F70L probably damaging Het
Pdzph1 A G 17: 58,932,481 S951P probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Rasgrp1 A T 2: 117,287,833 C558* probably null Het
Slc12a6 A T 2: 112,356,554 H966L probably benign Het
Snx14 A T 9: 88,415,687 V176D probably damaging Het
St6galnac3 G T 3: 153,205,492 H277Q probably damaging Het
Syde2 T A 3: 146,001,972 D822E possibly damaging Het
Syne2 A T 12: 75,942,907 E1853D probably benign Het
Tigd4 T C 3: 84,594,664 V296A possibly damaging Het
Tmed4 A T 11: 6,274,242 probably benign Het
Trmt6 A T 2: 132,809,906 I198N probably damaging Het
Wasl A T 6: 24,634,595 Y103N probably damaging Het
Zfp628 A G 7: 4,919,229 D150G probably damaging Het
Zfp936 T A 7: 43,189,424 V105D possibly damaging Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1862:Ubap2 UTSW 4 41221607 missense probably benign
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 splice site probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 splice site probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7695:Ubap2 UTSW 4 41211740 missense probably damaging 0.98
R7811:Ubap2 UTSW 4 41211710 missense probably benign 0.22
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCCTCCAGGCTTGTATC -3'
(R):5'- AAGCAGGGATTTCATGCCG -3'

Sequencing Primer
(F):5'- TTACACACAGCAGAGGGTCTGG -3'
(R):5'- AGGGATTTCATGCCGGGACTC -3'
Posted On2020-01-23