Incidental Mutation 'R0679:Cry2'
ID61719
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Namecryptochrome 2 (photolyase-like)
Synonyms
MMRRC Submission 038864-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R0679 (G1)
Quality Score162
Status Not validated
Chromosome2
Chromosomal Location92403646-92434043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92413715 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 371 (I371T)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
Predicted Effect probably damaging
Transcript: ENSMUST00000090559
AA Change: I371T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: I371T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111278
AA Change: I371T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: I371T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126002
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,223,122 V1943L probably benign Het
Adgrl3 G A 5: 81,794,977 D1507N probably damaging Het
L3mbtl3 T A 10: 26,313,933 K478* probably null Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Plcg1 C T 2: 160,756,910 P842S probably damaging Het
Ros1 T C 10: 52,066,295 R2111G possibly damaging Het
Sox10 A G 15: 79,156,588 S90P probably benign Het
Tbc1d32 A C 10: 56,180,576 Y423D probably damaging Het
Utp15 A T 13: 98,259,403 Y52N probably benign Het
Vps13b T G 15: 35,709,703 I1932S possibly damaging Het
Zfp457 A T 13: 67,293,591 C211S probably damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAAATCGGCATCCAGGAGCAG -3'
(R):5'- AACCCCAGGTTTGACCGAATGGAG -3'

Sequencing Primer
(F):5'- CAGCTCGTCAAATACCTAGATGAGG -3'
(R):5'- ATGGAGGGGAACCCCATCTG -3'
Posted On2013-07-30