Incidental Mutation 'R8016:Btla'
ID617191
Institutional Source Beutler Lab
Gene Symbol Btla
Ensembl Gene ENSMUSG00000052013
Gene NameB and T lymphocyte associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8016 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location45224315-45257670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45250587 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 304 (V304A)
Ref Sequence ENSEMBL: ENSMUSP00000067877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063654] [ENSMUST00000102802]
Predicted Effect probably damaging
Transcript: ENSMUST00000063654
AA Change: V304A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067877
Gene: ENSMUSG00000052013
AA Change: V304A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 182 204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102802
AA Change: V303A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099866
Gene: ENSMUSG00000052013
AA Change: V303A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 49 143 2.92e-5 SMART
transmembrane domain 181 203 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein contains a single immunoglobulin (Ig) domain and is a receptor that relays inhibitory signals to suppress the immune response. Alternative splicing results in multiple transcript variants. Polymorphisms in this gene have been associated with an increased risk of rheumatoid arthritis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted inactivation of this gene leads to increased T cell activation. Homozygotes for a null allele show altered peripheral T cell anergy. Homozygotes for a different null allele show enhanced specific antibody responses, increased susceptibility to EAE, and prolonged allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,364,952 M105K probably benign Het
Acer2 T C 4: 86,886,206 F53L probably damaging Het
Adam15 A G 3: 89,345,361 V307A probably benign Het
Afmid A G 11: 117,835,544 I193V probably benign Het
Ahdc1 C T 4: 133,062,915 T489M possibly damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Bag6 T A 17: 35,138,757 V133D unknown Het
Cacna1g A T 11: 94,443,181 I878N probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Clcnka A T 4: 141,390,152 S445T possibly damaging Het
Col6a6 A G 9: 105,767,528 V1187A possibly damaging Het
Col7a1 T C 9: 108,958,644 V664A unknown Het
Crb2 C A 2: 37,786,556 A183E possibly damaging Het
Cyp2j5 C T 4: 96,658,714 V188I probably damaging Het
D430041D05Rik A T 2: 104,192,519 N1043K probably damaging Het
Dnah14 G A 1: 181,648,311 R1376H probably benign Het
Foxj1 A G 11: 116,331,849 F376S probably damaging Het
Gm5771 A T 6: 41,397,166 Y234F probably damaging Het
Hsd17b11 A T 5: 104,021,660 I27N probably damaging Het
Itih1 A G 14: 30,935,294 V528A probably damaging Het
Ndor1 A G 2: 25,249,317 V283A probably benign Het
Nup54 G A 5: 92,434,317 T45I unknown Het
Olfr1186 G A 2: 88,526,173 V197I probably damaging Het
Olfr828 T C 9: 18,816,292 M1V probably null Het
Pbld2 T C 10: 63,047,965 F70L probably damaging Het
Pdzph1 A G 17: 58,932,481 S951P probably damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Rasgrp1 A T 2: 117,287,833 C558* probably null Het
Slc12a6 A T 2: 112,356,554 H966L probably benign Het
Snx14 A T 9: 88,415,687 V176D probably damaging Het
St6galnac3 G T 3: 153,205,492 H277Q probably damaging Het
Syde2 T A 3: 146,001,972 D822E possibly damaging Het
Syne2 A T 12: 75,942,907 E1853D probably benign Het
Tigd4 T C 3: 84,594,664 V296A possibly damaging Het
Tmed4 A T 11: 6,274,242 probably benign Het
Trmt6 A T 2: 132,809,906 I198N probably damaging Het
Ubap2 A G 4: 41,195,201 S1117P possibly damaging Het
Wasl A T 6: 24,634,595 Y103N probably damaging Het
Zfp628 A G 7: 4,919,229 D150G probably damaging Het
Zfp936 T A 7: 43,189,424 V105D possibly damaging Het
Other mutations in Btla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Btla APN 16 45250353 missense probably benign 0.34
IGL01774:Btla APN 16 45250548 missense possibly damaging 0.78
IGL03252:Btla APN 16 45239146 missense possibly damaging 0.56
IGL03266:Btla APN 16 45239275 missense probably damaging 0.98
Conundrum UTSW 16 45239298 missense probably damaging 1.00
Enigmatic UTSW 16 45239039 splice site probably null
Mysterious UTSW 16 45250573 nonsense probably null
R1373:Btla UTSW 16 45224420 missense probably benign 0.09
R1864:Btla UTSW 16 45250374 missense probably damaging 0.97
R2439:Btla UTSW 16 45239140 missense probably damaging 1.00
R4133:Btla UTSW 16 45239298 missense probably damaging 1.00
R4193:Btla UTSW 16 45250482 missense probably benign 0.00
R4948:Btla UTSW 16 45242728 missense probably benign 0.33
R5597:Btla UTSW 16 45244236 missense probably benign
R5666:Btla UTSW 16 45250419 missense probably damaging 1.00
R5670:Btla UTSW 16 45250419 missense probably damaging 1.00
R5700:Btla UTSW 16 45250573 nonsense probably null
R5859:Btla UTSW 16 45239039 splice site probably null
R6442:Btla UTSW 16 45224458 missense probably benign 0.00
R6442:Btla UTSW 16 45250350 missense possibly damaging 0.82
R6526:Btla UTSW 16 45239094 missense probably damaging 1.00
R6883:Btla UTSW 16 45242729 missense probably benign 0.09
R8098:Btla UTSW 16 45244249 nonsense probably null
Z1176:Btla UTSW 16 45239358 missense probably damaging 0.98
Z1177:Btla UTSW 16 45239272 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AATGATCCCTGGTCTAGCATGC -3'
(R):5'- ATGAGTTTTCCCAGGGAAGAG -3'

Sequencing Primer
(F):5'- CTGGTCTAGCATGCAGGATGAATC -3'
(R):5'- CCCAGGGAAGAGTCTGTCTTGTAC -3'
Posted On2020-01-23