Incidental Mutation 'R8016:Ccnf'
ID 617192
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Name cyclin F
Synonyms CycF, Fbxo1
MMRRC Submission 067456-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8016 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24441518-24470333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24450784 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 398 (I398N)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
AlphaFold P51944
Predicted Effect possibly damaging
Transcript: ENSMUST00000115390
AA Change: I398N

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: I398N

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175529
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,583,926 (GRCm39) M105K probably benign Het
Acer2 T C 4: 86,804,443 (GRCm39) F53L probably damaging Het
Adam15 A G 3: 89,252,668 (GRCm39) V307A probably benign Het
Afmid A G 11: 117,726,370 (GRCm39) I193V probably benign Het
Ahdc1 C T 4: 132,790,226 (GRCm39) T489M possibly damaging Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Bag6 T A 17: 35,357,733 (GRCm39) V133D unknown Het
Btla T C 16: 45,070,950 (GRCm39) V304A probably damaging Het
Cacna1g A T 11: 94,334,007 (GRCm39) I878N probably benign Het
Clcnka A T 4: 141,117,463 (GRCm39) S445T possibly damaging Het
Col6a6 A G 9: 105,644,727 (GRCm39) V1187A possibly damaging Het
Col7a1 T C 9: 108,787,712 (GRCm39) V664A unknown Het
Crb2 C A 2: 37,676,568 (GRCm39) A183E possibly damaging Het
Cyp2j5 C T 4: 96,546,951 (GRCm39) V188I probably damaging Het
D430041D05Rik A T 2: 104,022,864 (GRCm39) N1043K probably damaging Het
Dnah14 G A 1: 181,475,876 (GRCm39) R1376H probably benign Het
Foxj1 A G 11: 116,222,675 (GRCm39) F376S probably damaging Het
Hsd17b11 A T 5: 104,169,526 (GRCm39) I27N probably damaging Het
Itih1 A G 14: 30,657,251 (GRCm39) V528A probably damaging Het
Ndor1 A G 2: 25,139,329 (GRCm39) V283A probably benign Het
Nup54 G A 5: 92,582,176 (GRCm39) T45I unknown Het
Or4c100 G A 2: 88,356,517 (GRCm39) V197I probably damaging Het
Or7g16 T C 9: 18,727,588 (GRCm39) M1V probably null Het
Pbld2 T C 10: 62,883,744 (GRCm39) F70L probably damaging Het
Pdzph1 A G 17: 59,239,476 (GRCm39) S951P probably damaging Het
Peg10 T TCCA 6: 4,756,451 (GRCm39) probably benign Het
Prss1l A T 6: 41,374,100 (GRCm39) Y234F probably damaging Het
Rasgrp1 A T 2: 117,118,314 (GRCm39) C558* probably null Het
Slc12a6 A T 2: 112,186,899 (GRCm39) H966L probably benign Het
Snx14 A T 9: 88,297,740 (GRCm39) V176D probably damaging Het
St6galnac3 G T 3: 152,911,129 (GRCm39) H277Q probably damaging Het
Syde2 T A 3: 145,707,727 (GRCm39) D822E possibly damaging Het
Syne2 A T 12: 75,989,681 (GRCm39) E1853D probably benign Het
Tigd4 T C 3: 84,501,971 (GRCm39) V296A possibly damaging Het
Tmed4 A T 11: 6,224,242 (GRCm39) probably benign Het
Trmt6 A T 2: 132,651,826 (GRCm39) I198N probably damaging Het
Ubap2 A G 4: 41,195,201 (GRCm39) S1117P possibly damaging Het
Wasl A T 6: 24,634,594 (GRCm39) Y103N probably damaging Het
Zfp628 A G 7: 4,922,228 (GRCm39) D150G probably damaging Het
Zfp936 T A 7: 42,838,848 (GRCm39) V105D possibly damaging Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24,443,986 (GRCm39) missense probably damaging 1.00
IGL01942:Ccnf APN 17 24,461,294 (GRCm39) missense probably benign 0.03
IGL02251:Ccnf APN 17 24,445,513 (GRCm39) missense probably benign 0.00
IGL02945:Ccnf APN 17 24,443,890 (GRCm39) missense probably damaging 0.99
IGL02952:Ccnf APN 17 24,450,299 (GRCm39) missense possibly damaging 0.93
albuquerque UTSW 17 24,442,971 (GRCm39) nonsense probably null
R0326:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24,445,751 (GRCm39) missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24,442,971 (GRCm39) nonsense probably null
R1072:Ccnf UTSW 17 24,456,136 (GRCm39) missense probably damaging 0.97
R1693:Ccnf UTSW 17 24,445,514 (GRCm39) frame shift probably null
R2147:Ccnf UTSW 17 24,449,288 (GRCm39) critical splice donor site probably null
R3929:Ccnf UTSW 17 24,453,356 (GRCm39) missense probably damaging 1.00
R4081:Ccnf UTSW 17 24,442,872 (GRCm39) makesense probably null
R4260:Ccnf UTSW 17 24,445,741 (GRCm39) missense probably damaging 1.00
R4579:Ccnf UTSW 17 24,450,303 (GRCm39) nonsense probably null
R4651:Ccnf UTSW 17 24,450,760 (GRCm39) missense probably damaging 1.00
R4844:Ccnf UTSW 17 24,449,331 (GRCm39) nonsense probably null
R4876:Ccnf UTSW 17 24,449,311 (GRCm39) missense probably damaging 1.00
R5234:Ccnf UTSW 17 24,453,411 (GRCm39) nonsense probably null
R5352:Ccnf UTSW 17 24,462,247 (GRCm39) splice site probably null
R5845:Ccnf UTSW 17 24,459,767 (GRCm39) missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24,450,811 (GRCm39) missense probably damaging 1.00
R6219:Ccnf UTSW 17 24,445,678 (GRCm39) nonsense probably null
R7021:Ccnf UTSW 17 24,461,205 (GRCm39) missense probably damaging 1.00
R7176:Ccnf UTSW 17 24,468,376 (GRCm39) missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24,442,889 (GRCm39) missense probably benign 0.00
R7485:Ccnf UTSW 17 24,468,232 (GRCm39) missense probably damaging 0.97
R7763:Ccnf UTSW 17 24,443,986 (GRCm39) missense probably damaging 1.00
R8034:Ccnf UTSW 17 24,450,805 (GRCm39) missense probably damaging 1.00
R8069:Ccnf UTSW 17 24,443,989 (GRCm39) missense probably damaging 1.00
R9021:Ccnf UTSW 17 24,445,679 (GRCm39) nonsense probably null
R9623:Ccnf UTSW 17 24,468,367 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCTTTCTCCACAGCAG -3'
(R):5'- AGAAGCAAGTGGATTCGCTC -3'

Sequencing Primer
(F):5'- AGTAGCGCTCAATGGCCTCAG -3'
(R):5'- AGTCTGGAGCCATCCCATCATG -3'
Posted On 2020-01-23