Incidental Mutation 'R8018:Secisbp2l'
ID617200
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.771) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 125745909 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 762 (R762L)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect probably damaging
Transcript: ENSMUST00000053699
AA Change: R762L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: R762L

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093
AA Change: R387L

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Ccdc158 T C 5: 92,623,401 D985G possibly damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Gmip A G 8: 69,815,493 E399G probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Phf10 T A 17: 14,954,116 Q233H possibly damaging Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tia1 C T 6: 86,425,052 P189S probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ubxn8 A G 8: 33,623,215 C204R probably damaging Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
R7762:Secisbp2l UTSW 2 125768193 missense probably damaging 1.00
R7769:Secisbp2l UTSW 2 125771545 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AGTCACTAACTCACTCCTGGC -3'
(R):5'- GCCCTACAGAGAAACTAAAGTACTG -3'

Sequencing Primer
(F):5'- ACAGCTGTACATAACCTTGCTTGG -3'
(R):5'- ACAAATATGTAAATGTGGGTGGTTG -3'
Posted On2020-01-23