Incidental Mutation 'R8018:Ccdc158'
ID617208
Institutional Source Beutler Lab
Gene Symbol Ccdc158
Ensembl Gene ENSMUSG00000050050
Gene Namecoiled-coil domain containing 158
Synonyms4932413O14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location92607954-92675271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92623401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 985 (D985G)
Ref Sequence ENSEMBL: ENSMUSP00000063050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060930]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060930
AA Change: D985G

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063050
Gene: ENSMUSG00000050050
AA Change: D985G

DomainStartEndE-ValueType
Pfam:CCDC158 1 1109 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Gmip A G 8: 69,815,493 E399G probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Phf10 T A 17: 14,954,116 Q233H possibly damaging Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Secisbp2l C A 2: 125,745,909 R762L probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tia1 C T 6: 86,425,052 P189S probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ubxn8 A G 8: 33,623,215 C204R probably damaging Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Ccdc158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Ccdc158 APN 5 92657881 missense probably benign 0.01
IGL00926:Ccdc158 APN 5 92650767 missense probably damaging 0.98
IGL01533:Ccdc158 APN 5 92609956 splice site probably null
IGL01551:Ccdc158 APN 5 92666761 missense probably damaging 0.96
IGL01591:Ccdc158 APN 5 92662041 missense probably benign 0.28
IGL01722:Ccdc158 APN 5 92662739 missense possibly damaging 0.93
IGL02250:Ccdc158 APN 5 92608478 missense probably damaging 1.00
IGL02457:Ccdc158 APN 5 92650048 missense probably damaging 1.00
IGL02570:Ccdc158 APN 5 92649026 missense possibly damaging 0.81
IGL02951:Ccdc158 APN 5 92650006 missense probably damaging 1.00
IGL03275:Ccdc158 APN 5 92629632 missense probably benign 0.00
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0238:Ccdc158 UTSW 5 92662118 missense probably benign 0.31
R0747:Ccdc158 UTSW 5 92633297 missense probably benign 0.00
R1219:Ccdc158 UTSW 5 92654181 splice site probably benign
R1480:Ccdc158 UTSW 5 92649044 missense probably damaging 1.00
R1926:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R2172:Ccdc158 UTSW 5 92632508 missense probably damaging 1.00
R2245:Ccdc158 UTSW 5 92609952 unclassified probably benign
R3004:Ccdc158 UTSW 5 92649070 missense probably damaging 1.00
R3147:Ccdc158 UTSW 5 92657963 missense probably damaging 1.00
R3693:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3694:Ccdc158 UTSW 5 92610045 missense probably damaging 1.00
R3735:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3736:Ccdc158 UTSW 5 92632424 missense possibly damaging 0.60
R3912:Ccdc158 UTSW 5 92648935 missense possibly damaging 0.90
R4026:Ccdc158 UTSW 5 92643807 missense probably benign 0.07
R4080:Ccdc158 UTSW 5 92623396 missense probably benign 0.00
R4463:Ccdc158 UTSW 5 92634300 missense probably null 0.99
R4483:Ccdc158 UTSW 5 92633328 missense probably benign 0.01
R4859:Ccdc158 UTSW 5 92633403 missense probably damaging 0.99
R5016:Ccdc158 UTSW 5 92657892 missense probably benign 0.01
R5050:Ccdc158 UTSW 5 92666879 missense probably benign 0.01
R5372:Ccdc158 UTSW 5 92632560 missense possibly damaging 0.55
R5427:Ccdc158 UTSW 5 92648962 missense probably damaging 1.00
R5847:Ccdc158 UTSW 5 92627480 missense probably benign 0.00
R5966:Ccdc158 UTSW 5 92650049 missense probably damaging 1.00
R6106:Ccdc158 UTSW 5 92627466 missense probably benign
R6185:Ccdc158 UTSW 5 92666854 missense possibly damaging 0.73
R6562:Ccdc158 UTSW 5 92662722 missense probably damaging 0.99
R6743:Ccdc158 UTSW 5 92662146 missense probably benign 0.08
R6815:Ccdc158 UTSW 5 92612486 missense probably damaging 0.99
R6914:Ccdc158 UTSW 5 92662070 missense probably benign 0.00
R6975:Ccdc158 UTSW 5 92666720 nonsense probably null
R7252:Ccdc158 UTSW 5 92650788 missense probably benign 0.41
R7477:Ccdc158 UTSW 5 92650696 missense probably damaging 0.96
R7782:Ccdc158 UTSW 5 92645514 missense probably benign 0.00
R8014:Ccdc158 UTSW 5 92649030 missense probably damaging 1.00
X0025:Ccdc158 UTSW 5 92662012 missense probably benign
Z1176:Ccdc158 UTSW 5 92608491 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAATCTGAGGTGGTTGGC -3'
(R):5'- TACTCCCATGACTAGGCTCC -3'

Sequencing Primer
(F):5'- CAATGTTGGCACTGTAGGTGG -3'
(R):5'- GAGAGCCTCCACAGTCCAGTC -3'
Posted On2020-01-23