Mutagenetix > Incidental Mutation

Incidental Mutation 'R0679:Adgrl3'

61721

Institutional Source

Beutler Lab

Gene Symbol

Adgrl3

Ensembl Gene

ENSMUSG00000037605

Gene Name

adhesion G protein-coupled receptor L3

Synonyms

LEC3, 5430402I23Rik, lectomedin 3, Lphn3, D130075K09Rik

MMRRC Submission

038864-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0679 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

81020138-81825133 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 81794977 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1507 (D1507N)

Ref Sequence

ENSEMBL: ENSMUSP00000112823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036068] [ENSMUST00000072521] [ENSMUST00000117253] [ENSMUST00000117407] [ENSMUST00000117985] [ENSMUST00000118034] [ENSMUST00000118078] [ENSMUST00000118442] [ENSMUST00000119385] [ENSMUST00000119788] [ENSMUST00000120128] [ENSMUST00000120144] [ENSMUST00000120673] [ENSMUST00000121707] [ENSMUST00000122037] [ENSMUST00000121641] [ENSMUST00000122356] [ENSMUST00000120292] [ENSMUST00000120445] [ENSMUST00000132375]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000036068
AA Change: D1516N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045342
Gene: ENSMUSG00000037605
AA Change: D1516N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	6.6e-27	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	1.1e-7	PFAM
Pfam:DUF3497	627	857	2.2e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	4.4e-72	PFAM
Pfam:Latrophilin	1206	1276	2.4e-30	PFAM
Pfam:Latrophilin	1272	1543	3.2e-113	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000072521
AA Change: D1516N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072336
Gene: ENSMUSG00000037605
AA Change: D1516N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	5.9e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	4.3e-8	PFAM
Pfam:GAIN	630	856	1.2e-58	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	2.5e-73	PFAM
Pfam:Latrophilin	1207	1274	4e-34	PFAM
Pfam:Latrophilin	1272	1543	5e-89	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117253

SMART Domains

Protein: ENSMUSP00000112470
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.5e-8	PFAM
Pfam:DUF3497	559	789	1.2e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	5e-73	PFAM
Pfam:Latrophilin	1129	1265	7.5e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000117407

SMART Domains

Protein: ENSMUSP00000112388
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.4e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	6e-8	PFAM
Pfam:DUF3497	627	857	2.6e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	7.7e-73	PFAM
Pfam:Latrophilin	1197	1321	1.8e-61	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117985
AA Change: D1485N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113950
Gene: ENSMUSG00000037605
AA Change: D1485N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1.3e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	5.5e-8	PFAM
Pfam:DUF3497	559	789	1.6e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1119	1.7e-72	PFAM
Pfam:Latrophilin	1138	1512	6.8e-178	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118034
AA Change: D1476N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113534
Gene: ENSMUSG00000037605
AA Change: D1476N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1.2e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	5.5e-8	PFAM
Pfam:DUF3497	559	789	1.6e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	6.6e-73	PFAM
Pfam:Latrophilin	1129	1503	6.7e-178	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118078

SMART Domains

Protein: ENSMUSP00000112731
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	9.7e-27	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.3e-8	PFAM
Pfam:DUF3497	559	789	1.2e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	4.8e-73	PFAM
Pfam:Latrophilin	1129	1201	2.6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118442

SMART Domains

Protein: ENSMUSP00000113836
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	4.7e-8	PFAM
Pfam:DUF3497	627	857	1.3e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.4e-72	PFAM
Pfam:Latrophilin	1206	1278	2.8e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119385

SMART Domains

Protein: ENSMUSP00000113243
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	4.6e-8	PFAM
Pfam:DUF3497	627	857	1.3e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	5.2e-73	PFAM
Pfam:Latrophilin	1197	1269	2.7e-30	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000119788
AA Change: D1523N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114067
Gene: ENSMUSG00000037605
AA Change: D1523N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1.3e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	5.7e-8	PFAM
Pfam:DUF3497	627	857	1.7e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.8e-72	PFAM
Pfam:Latrophilin	1206	1279	3.6e-31	PFAM
Pfam:Latrophilin	1273	1550	4.5e-113	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120128

SMART Domains

Protein: ENSMUSP00000113208
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	9.8e-27	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.4e-8	PFAM
Pfam:DUF3497	559	789	1.2e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1119	1.3e-72	PFAM
Pfam:Latrophilin	1138	1210	2.6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120144

SMART Domains

Protein: ENSMUSP00000113619
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.5e-8	PFAM
Pfam:DUF3497	559	789	1.3e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	5.1e-73	PFAM
Pfam:Latrophilin	1129	1253	8.4e-62	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120673
AA Change: D1553N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113482
Gene: ENSMUSG00000037605
AA Change: D1553N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.7e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	3.3e-8	PFAM
Pfam:GAIN	630	856	6.4e-59	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.8e-73	PFAM
Pfam:Latrophilin	1207	1580	1.4e-158	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121707
AA Change: D1507N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112823
Gene: ENSMUSG00000037605
AA Change: D1507N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1.3e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	5.6e-8	PFAM
Pfam:DUF3497	627	857	1.7e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	6.8e-73	PFAM
Pfam:Latrophilin	1197	1267	6.4e-30	PFAM
Pfam:Latrophilin	1263	1534	8.7e-113	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122037
AA Change: D1433N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113374
Gene: ENSMUSG00000037605
AA Change: D1433N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1.2e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	5.3e-8	PFAM
Pfam:DUF3497	559	789	1.5e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1110	6.3e-73	PFAM
Pfam:Latrophilin	1129	1199	4.4e-30	PFAM
Pfam:Latrophilin	1194	1460	1.3e-112	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000121641
AA Change: D1544N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113694
Gene: ENSMUSG00000037605
AA Change: D1544N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	1.3e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	5.8e-8	PFAM
Pfam:DUF3497	627	857	1.7e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	7e-73	PFAM
Pfam:Latrophilin	1197	1571	7.3e-178	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000124117
AA Change: D845N

SMART Domains

Protein: ENSMUSP00000118882
Gene: ENSMUSG00000037605
AA Change: D845N

Domain	Start	End	E-Value	Type
Pfam:GAIN	2	201	1.8e-51	PFAM
GPS	227	279	3.72e-25	SMART
Pfam:7tm_2	287	523	9.1e-75	PFAM
Pfam:Latrophilin	543	610	7.2e-35	PFAM
Pfam:Latrophilin	607	873	1.8e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000122356
AA Change: D1501N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113600
Gene: ENSMUSG00000037605
AA Change: D1501N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.8e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	7e-8	PFAM
Pfam:DUF3497	627	857	3.1e-84	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1178	9.3e-73	PFAM
Pfam:Latrophilin	1197	1267	9e-30	PFAM
Pfam:Latrophilin	1262	1528	2.8e-112	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139469

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153264

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148830

Predicted Effect

probably benign
Transcript: ENSMUST00000120292

SMART Domains

Protein: ENSMUSP00000112548
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Gal_Lectin	43	123	1e-26	PFAM
OLF	137	393	2.71e-170	SMART
low complexity region	426	448	N/A	INTRINSIC
Pfam:HRM	495	553	4.5e-8	PFAM
Pfam:DUF3497	559	789	1.3e-84	PFAM
GPS	814	866	3.72e-25	SMART
Pfam:7tm_2	874	1119	1.3e-72	PFAM
Pfam:Latrophilin	1138	1262	8.5e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000120445

SMART Domains

Protein: ENSMUSP00000113249
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	62	87	N/A	INTRINSIC
Pfam:Gal_Lectin	111	191	2.2e-26	PFAM
OLF	205	461	2.71e-170	SMART
low complexity region	494	516	N/A	INTRINSIC
Pfam:HRM	563	621	2.8e-8	PFAM
Pfam:GAIN	630	856	5.1e-59	PFAM
GPS	882	934	3.72e-25	SMART
Pfam:7tm_2	942	1187	1.4e-73	PFAM
Pfam:Latrophilin	1207	1328	8e-64	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132375

SMART Domains

Protein: ENSMUSP00000117211
Gene: ENSMUSG00000037605

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.5%
20x: 91.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors (GPCR). Latrophilins may function in both cell adhesion and signal transduction. In experiments with non-human species, endogenous proteolytic cleavage within a cysteine-rich GPS (G-protein-coupled-receptor proteolysis site) domain resulted in two subunits (a large extracellular N-terminal cell adhesion subunit and a subunit with substantial similarity to the secretin/calcitonin family of GPCRs) being non-covalently bound at the cell membrane. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased dopamine and serotonine levels in the dorsal striatum, hyperactivity, increased stereotypic behavior and enhanced hyperactivity in response to cocaine. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 11 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	T	15: 8,223,122	V1943L	probably benign	Het
Cry2	A	G	2: 92,413,715	I371T	probably damaging	Het
L3mbtl3	T	A	10: 26,313,933	K478*	probably null	Het
Olfr196	G	A	16: 59,167,616	H176Y	probably damaging	Het
Plcg1	C	T	2: 160,756,910	P842S	probably damaging	Het
Ros1	T	C	10: 52,066,295	R2111G	possibly damaging	Het
Sox10	A	G	15: 79,156,588	S90P	probably benign	Het
Tbc1d32	A	C	10: 56,180,576	Y423D	probably damaging	Het
Utp15	A	T	13: 98,259,403	Y52N	probably benign	Het
Vps13b	T	G	15: 35,709,703	I1932S	possibly damaging	Het
Zfp457	A	T	13: 67,293,591	C211S	probably damaging	Het

Other mutations in Adgrl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00391:Adgrl3	APN	5	81724224	missense	probably damaging	0.99
IGL00596:Adgrl3	APN	5	81646467	missense	probably benign	0.01
IGL00766:Adgrl3	APN	5	81794568	missense	probably damaging	1.00
IGL00787:Adgrl3	APN	5	81693554	missense	probably damaging	1.00
IGL00917:Adgrl3	APN	5	81693574	missense	possibly damaging	0.93
IGL01155:Adgrl3	APN	5	81560893	missense	probably benign	0.39
IGL01348:Adgrl3	APN	5	81726723	missense	probably damaging	1.00
IGL01401:Adgrl3	APN	5	81688669	missense	possibly damaging	0.94
IGL01443:Adgrl3	APN	5	81465287	missense	probably damaging	1.00
IGL01532:Adgrl3	APN	5	81694569	missense	probably damaging	1.00
IGL01779:Adgrl3	APN	5	81387870	missense	probably damaging	1.00
IGL01920:Adgrl3	APN	5	81465296	missense	probably damaging	1.00
IGL02065:Adgrl3	APN	5	81512217	missense	probably damaging	1.00
IGL02365:Adgrl3	APN	5	81512581	missense	probably damaging	1.00
IGL02879:Adgrl3	APN	5	81512119	missense	probably damaging	1.00
R0010:Adgrl3	UTSW	5	81792403	missense	possibly damaging	0.58
R0077:Adgrl3	UTSW	5	81771685	splice site	probably benign
R0103:Adgrl3	UTSW	5	81792347	intron	probably benign
R0138:Adgrl3	UTSW	5	81693607	missense	probably damaging	1.00
R0149:Adgrl3	UTSW	5	81760697	missense	probably damaging	1.00
R0349:Adgrl3	UTSW	5	81771644	missense	probably damaging	1.00
R0361:Adgrl3	UTSW	5	81760697	missense	probably damaging	1.00
R0522:Adgrl3	UTSW	5	81726801	missense	possibly damaging	0.91
R0610:Adgrl3	UTSW	5	81693716	splice site	probably benign
R0658:Adgrl3	UTSW	5	81648713	missense	probably benign	0.18
R0671:Adgrl3	UTSW	5	81560905	missense	probably benign	0.45
R1413:Adgrl3	UTSW	5	81693519	missense	probably damaging	1.00
R1444:Adgrl3	UTSW	5	81512353	missense	probably damaging	1.00
R1574:Adgrl3	UTSW	5	81787449	missense	probably damaging	1.00
R1574:Adgrl3	UTSW	5	81787449	missense	probably damaging	1.00
R1738:Adgrl3	UTSW	5	81387979	missense	probably damaging	0.99
R1744:Adgrl3	UTSW	5	81794420	missense	probably damaging	1.00
R1803:Adgrl3	UTSW	5	81771617	nonsense	probably null
R1891:Adgrl3	UTSW	5	81512044	missense	probably damaging	1.00
R1988:Adgrl3	UTSW	5	81688567	missense	probably damaging	1.00
R2126:Adgrl3	UTSW	5	81512536	missense	probably damaging	1.00
R2136:Adgrl3	UTSW	5	81512254	missense	probably damaging	1.00
R2171:Adgrl3	UTSW	5	81512515	nonsense	probably null
R2891:Adgrl3	UTSW	5	81693519	missense	probably damaging	1.00
R3508:Adgrl3	UTSW	5	81724256	missense	probably damaging	1.00
R3732:Adgrl3	UTSW	5	81794946	missense	probably benign	0.05
R3732:Adgrl3	UTSW	5	81794946	missense	probably benign	0.05
R3733:Adgrl3	UTSW	5	81794946	missense	probably benign	0.05
R3982:Adgrl3	UTSW	5	81694526	missense	possibly damaging	0.95
R4085:Adgrl3	UTSW	5	81512544	missense	probably benign	0.02
R4462:Adgrl3	UTSW	5	81688510	missense	probably damaging	1.00
R4725:Adgrl3	UTSW	5	81766205	missense	possibly damaging	0.67
R4726:Adgrl3	UTSW	5	81646578	missense	possibly damaging	0.61
R4781:Adgrl3	UTSW	5	81760724	missense	probably damaging	1.00
R4837:Adgrl3	UTSW	5	81766234	missense	probably benign	0.07
R4841:Adgrl3	UTSW	5	81794271	missense	possibly damaging	0.53
R4883:Adgrl3	UTSW	5	81689646	missense	probably damaging	1.00
R4921:Adgrl3	UTSW	5	81512110	missense	probably damaging	1.00
R4945:Adgrl3	UTSW	5	81512048	missense	probably damaging	1.00
R5055:Adgrl3	UTSW	5	81646551	missense	possibly damaging	0.48
R5313:Adgrl3	UTSW	5	81726669	missense	probably damaging	1.00
R5385:Adgrl3	UTSW	5	81726801	missense	probably damaging	1.00
R5447:Adgrl3	UTSW	5	81465341	intron	probably benign
R5482:Adgrl3	UTSW	5	81794513	missense	probably damaging	1.00
R5586:Adgrl3	UTSW	5	81724147	missense	probably damaging	0.99
R5637:Adgrl3	UTSW	5	81693544	missense	probably damaging	1.00
R5919:Adgrl3	UTSW	5	81646570	missense	probably benign	0.00
R6090:Adgrl3	UTSW	5	81512326	missense	probably damaging	1.00
R6093:Adgrl3	UTSW	5	81646522	missense	probably benign	0.42
R6107:Adgrl3	UTSW	5	81688563	missense	probably damaging	0.97
R6245:Adgrl3	UTSW	5	81688556	missense	probably benign	0.01
R6426:Adgrl3	UTSW	5	81726870	missense	probably damaging	1.00
R6440:Adgrl3	UTSW	5	81794494	nonsense	probably null
R6516:Adgrl3	UTSW	5	81465272	missense	probably damaging	1.00
R6527:Adgrl3	UTSW	5	81787517	missense	probably damaging	0.99
R6622:Adgrl3	UTSW	5	81794759	missense	probably benign	0.34
R6842:Adgrl3	UTSW	5	81741080	missense	probably damaging	1.00
R6902:Adgrl3	UTSW	5	81689587	missense	probably damaging	1.00
R6921:Adgrl3	UTSW	5	81648713	missense	probably damaging	0.99
R7201:Adgrl3	UTSW	5	81724222	missense	probably damaging	1.00
R7207:Adgrl3	UTSW	5	81310027	start codon destroyed	probably null	0.33
R7215:Adgrl3	UTSW	5	81693550	missense	probably damaging	1.00
R7376:Adgrl3	UTSW	5	81794750	missense	probably damaging	1.00
R7441:Adgrl3	UTSW	5	81724140	missense	possibly damaging	0.70
R7582:Adgrl3	UTSW	5	81693676	missense	probably damaging	0.99
R7682:Adgrl3	UTSW	5	81794560	missense	probably damaging	0.97
R7863:Adgrl3	UTSW	5	81512749	missense	probably damaging	1.00
R7877:Adgrl3	UTSW	5	81694620	missense	probably benign	0.30
R8051:Adgrl3	UTSW	5	81465266	missense	probably damaging	1.00
R8237:Adgrl3	UTSW	5	81787561	frame shift	probably null
R8390:Adgrl3	UTSW	5	81766210	missense	probably damaging	1.00
R8392:Adgrl3	UTSW	5	81646550	missense	probably benign	0.01
R8475:Adgrl3	UTSW	5	81724129	missense	probably benign	0.31
R8478:Adgrl3	UTSW	5	81794501	missense	possibly damaging	0.87
R8550:Adgrl3	UTSW	5	81794752	missense	possibly damaging	0.79
R8685:Adgrl3	UTSW	5	81726861	missense	possibly damaging	0.91
R8792:Adgrl3	UTSW	5	81688675	missense	probably damaging	0.99
R8851:Adgrl3	UTSW	5	81465272	missense	probably damaging	1.00
R8868:Adgrl3	UTSW	5	81646604	missense	probably benign
R8889:Adgrl3	UTSW	5	81726669	missense	probably damaging	1.00
R8892:Adgrl3	UTSW	5	81726669	missense	probably damaging	1.00
R8942:Adgrl3	UTSW	5	81648721	missense	probably benign	0.09
R9023:Adgrl3	UTSW	5	81465218	missense	probably damaging	0.99
R9089:Adgrl3	UTSW	5	81660444	missense	possibly damaging	0.77
R9100:Adgrl3	UTSW	5	81694452	missense	possibly damaging	0.85
R9104:Adgrl3	UTSW	5	81310065	missense	probably benign	0.00
R9172:Adgrl3	UTSW	5	81774404	missense	probably benign	0.01
R9284:Adgrl3	UTSW	5	81509721	splice site	probably benign
R9286:Adgrl3	UTSW	5	81646566	missense	probably benign
R9644:Adgrl3	UTSW	5	81724189	missense	probably damaging	0.99
R9689:Adgrl3	UTSW	5	81794933	missense	probably damaging	0.98
R9757:Adgrl3	UTSW	5	81465239	missense	probably benign	0.07
R9795:Adgrl3	UTSW	5	81689574	missense	probably damaging	1.00
Z1088:Adgrl3	UTSW	5	81329882	missense	probably benign	0.33
Z1088:Adgrl3	UTSW	5	81512158	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTACTCCACGGATAACCACCAGC -3'
(R):5'- ATCGACTCAGAATGGTCCACCAGG -3'

Sequencing Primer
(F):5'- AGGGACTCTCTGTACACCAG -3'
(R):5'- AATGGTCCACCAGGTGTTAG -3'

Posted On

2013-07-30