Incidental Mutation 'R8018:Tia1'
ID617213
Institutional Source Beutler Lab
Gene Symbol Tia1
Ensembl Gene ENSMUSG00000071337
Gene Namecytotoxic granule-associated RNA binding protein 1
Synonyms2310050N03Rik, mTIA-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location86404219-86433405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86425052 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 189 (P189S)
Ref Sequence ENSEMBL: ENSMUSP00000093425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095752] [ENSMUST00000095753] [ENSMUST00000095754] [ENSMUST00000113712] [ENSMUST00000113713] [ENSMUST00000123267] [ENSMUST00000130967] [ENSMUST00000148728] [ENSMUST00000154438] [ENSMUST00000204137]
PDB Structure
Solution structure of the second RNA recognition motif (RRM) of TIA-1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000095752
AA Change: P178S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093424
Gene: ENSMUSG00000071337
AA Change: P178S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 271 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095753
AA Change: P189S

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093425
Gene: ENSMUSG00000071337
AA Change: P189S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095754
AA Change: P189S

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000093426
Gene: ENSMUSG00000071337
AA Change: P189S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
RRM 215 282 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113712
AA Change: P189S

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138652
Gene: ENSMUSG00000071337
AA Change: P189S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
low complexity region 82 104 N/A INTRINSIC
RRM 107 180 5.15e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113713
AA Change: P180S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109342
Gene: ENSMUSG00000071337
AA Change: P180S

DomainStartEndE-ValueType
RRM 8 81 1.62e-23 SMART
RRM 98 171 5.15e-26 SMART
RRM 206 273 2.25e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123267
SMART Domains Protein: ENSMUSP00000145407
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 12 79 1e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130967
AA Change: P178S

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118558
Gene: ENSMUSG00000071337
AA Change: P178S

DomainStartEndE-ValueType
RRM 8 79 1.74e-23 SMART
RRM 96 169 5.15e-26 SMART
RRM 204 258 1.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148728
SMART Domains Protein: ENSMUSP00000144857
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Pfam:RRM_1 97 131 1.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154438
SMART Domains Protein: ENSMUSP00000145218
Gene: ENSMUSG00000071337

DomainStartEndE-ValueType
RRM 8 79 7.3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204137
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a member of a RNA-binding protein family and possesses nucleolytic activity against cytotoxic lymphocyte (CTL) target cells. It has been suggested that this protein may be involved in the induction of apoptosis as it preferentially recognizes poly(A) homopolymers and induces DNA fragmentation in CTL targets. The major granule-associated species is a 15-kDa protein that is thought to be derived from the carboxyl terminus of the 40-kDa product by proteolytic processing. Alternative splicing resulting in different isoforms of this gene product has been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced postnatal survival and functional abnormalities in the immune system with no gross abnormalities in any of the major organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Ccdc158 T C 5: 92,623,401 D985G possibly damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Gmip A G 8: 69,815,493 E399G probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Phf10 T A 17: 14,954,116 Q233H possibly damaging Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Secisbp2l C A 2: 125,745,909 R762L probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ubxn8 A G 8: 33,623,215 C204R probably damaging Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Tia1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02643:Tia1 APN 6 86416390 missense probably benign 0.16
R0322:Tia1 UTSW 6 86420387 missense probably damaging 1.00
R1118:Tia1 UTSW 6 86419109 missense probably benign 0.00
R1451:Tia1 UTSW 6 86430339 missense probably benign 0.00
R1631:Tia1 UTSW 6 86420348 missense probably damaging 1.00
R2275:Tia1 UTSW 6 86427677 missense probably benign 0.00
R2509:Tia1 UTSW 6 86424330 splice site probably null
R3952:Tia1 UTSW 6 86416337 missense probably damaging 1.00
R4596:Tia1 UTSW 6 86420407 missense probably benign 0.34
R4674:Tia1 UTSW 6 86420400 missense probably damaging 0.99
R4919:Tia1 UTSW 6 86424323 unclassified probably benign
R6339:Tia1 UTSW 6 86426656 missense probably damaging 1.00
R6455:Tia1 UTSW 6 86420378 missense probably damaging 1.00
R7139:Tia1 UTSW 6 86427688 missense possibly damaging 0.95
R7804:Tia1 UTSW 6 86424382 missense probably benign 0.02
R7879:Tia1 UTSW 6 86424365 missense probably damaging 0.97
R7962:Tia1 UTSW 6 86424365 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTATTGTGTGTTCCCTAAGGAC -3'
(R):5'- TGCTCTACTTAACAGGAGACTTGAC -3'

Sequencing Primer
(F):5'- GTGTGTTCCCTAAGGACTTTTTC -3'
(R):5'- ACTTAACAGGAGACTTGACATTAAAG -3'
Posted On2020-01-23