Incidental Mutation 'R8018:Ubxn8'
ID617220
Institutional Source Beutler Lab
Gene Symbol Ubxn8
Ensembl Gene ENSMUSG00000052906
Gene NameUBX domain protein 8
SynonymsRep8h, Rep-8, D0H8S2298E, Ubxd6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location33619586-33641967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33623215 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 204 (C204R)
Ref Sequence ENSEMBL: ENSMUSP00000092992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009774] [ENSMUST00000095349]
Predicted Effect probably benign
Transcript: ENSMUST00000009774
SMART Domains Protein: ENSMUSP00000009774
Gene: ENSMUSG00000009630

DomainStartEndE-ValueType
PP2Ac 23 293 2.48e-156 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095349
AA Change: C204R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092992
Gene: ENSMUSG00000052906
AA Change: C204R

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:UBX 192 271 3.8e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] p97 or VCP (valosin-containing protein) is a versatile ATPase complex, and many cofactors are required for the p97 functional diversity. This gene encodes one of the p97 cofactors. This cofactor is a transmembrane protein and localized in the endoplasmic reticulum (ER) membrane. It tethers p97 to the ER membrane via its UBX domain. The association of this cofactor with p97 facilitates efficient ER-associated degradation of misfolded proteins. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Ccdc158 T C 5: 92,623,401 D985G possibly damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Gmip A G 8: 69,815,493 E399G probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Phf10 T A 17: 14,954,116 Q233H possibly damaging Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Secisbp2l C A 2: 125,745,909 R762L probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tia1 C T 6: 86,425,052 P189S probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Ubxn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ubxn8 APN 8 33635305 missense probably benign 0.12
IGL01588:Ubxn8 APN 8 33621559 missense probably damaging 1.00
IGL01769:Ubxn8 APN 8 33629378 splice site probably benign
IGL02074:Ubxn8 APN 8 33623178 missense possibly damaging 0.77
PIT4468001:Ubxn8 UTSW 8 33621541 missense probably benign 0.10
R0098:Ubxn8 UTSW 8 33635365 splice site probably benign
R0098:Ubxn8 UTSW 8 33635365 splice site probably benign
R1167:Ubxn8 UTSW 8 33641901 missense probably damaging 0.97
R5203:Ubxn8 UTSW 8 33633611 missense probably damaging 0.98
R5299:Ubxn8 UTSW 8 33641919 missense possibly damaging 0.66
R6694:Ubxn8 UTSW 8 33621544 missense possibly damaging 0.59
R7266:Ubxn8 UTSW 8 33623203 missense probably damaging 0.99
R7526:Ubxn8 UTSW 8 33633607 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AAACCCTCAGTCTGCAATGC -3'
(R):5'- AGAGTTCCCATCTGGACTTCTG -3'

Sequencing Primer
(F):5'- CAATGCAGAACCTTCACATTGTCTG -3'
(R):5'- GGTGACCACTGTAGCTTACG -3'
Posted On2020-01-23