Incidental Mutation 'R8018:Gmip'
ID617222
Institutional Source Beutler Lab
Gene Symbol Gmip
Ensembl Gene ENSMUSG00000036246
Gene NameGem-interacting protein
Synonyms5031419I10Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69808679-69821870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69815493 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 399 (E399G)
Ref Sequence ENSEMBL: ENSMUSP00000045676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036074] [ENSMUST00000123453]
Predicted Effect probably benign
Transcript: ENSMUST00000036074
AA Change: E399G

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045676
Gene: ENSMUSG00000036246
AA Change: E399G

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-149 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Blast:RhoGAP 824 971 1e-53 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000123453
AA Change: E399G

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000116542
Gene: ENSMUSG00000036246
AA Change: E399G

DomainStartEndE-ValueType
PDB:3QWE|A 85 356 1e-150 PDB
low complexity region 358 367 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
C1 491 536 1.75e-6 SMART
RhoGAP 561 753 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142659
SMART Domains Protein: ENSMUSP00000114525
Gene: ENSMUSG00000036246

DomainStartEndE-ValueType
Blast:RhoGAP 2 25 1e-7 BLAST
SCOP:d1f7ca_ 3 32 7e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARHGAP family of Rho/Rac/Cdc42-like GTPase activating proteins. The encoded protein interacts with the Ras-related protein Gem through its N-terminal domain. Separately, it interacts with RhoA through a RhoGAP domain, and stimulates RhoA-dependent GTPase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Ccdc158 T C 5: 92,623,401 D985G possibly damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Phf10 T A 17: 14,954,116 Q233H possibly damaging Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Secisbp2l C A 2: 125,745,909 R762L probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tia1 C T 6: 86,425,052 P189S probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ubxn8 A G 8: 33,623,215 C204R probably damaging Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Gmip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gmip APN 8 69817011 nonsense probably null
IGL02529:Gmip APN 8 69816789 missense probably damaging 0.99
IGL03185:Gmip APN 8 69809783 missense probably benign 0.02
IGL03328:Gmip APN 8 69811611 missense possibly damaging 0.79
microdot UTSW 8 69814135 missense probably damaging 1.00
minnox UTSW 8 69817802 missense probably benign 0.02
R0110:Gmip UTSW 8 69815609 unclassified probably benign
R0329:Gmip UTSW 8 69810818 missense probably benign 0.06
R0330:Gmip UTSW 8 69810818 missense probably benign 0.06
R0510:Gmip UTSW 8 69815609 unclassified probably benign
R0638:Gmip UTSW 8 69811445 splice site probably benign
R1692:Gmip UTSW 8 69813903 missense probably benign
R1721:Gmip UTSW 8 69811232 missense probably damaging 0.96
R1755:Gmip UTSW 8 69814124 missense probably damaging 1.00
R1801:Gmip UTSW 8 69814477 missense probably benign
R1894:Gmip UTSW 8 69820972 missense probably damaging 1.00
R1926:Gmip UTSW 8 69815520 missense probably benign 0.41
R2005:Gmip UTSW 8 69814043 missense probably benign
R4280:Gmip UTSW 8 69813601 unclassified probably benign
R4281:Gmip UTSW 8 69813601 unclassified probably benign
R4282:Gmip UTSW 8 69813601 unclassified probably benign
R4283:Gmip UTSW 8 69813601 unclassified probably benign
R5221:Gmip UTSW 8 69814135 missense probably damaging 1.00
R5512:Gmip UTSW 8 69817890 missense probably benign 0.00
R5521:Gmip UTSW 8 69817399 missense probably damaging 1.00
R5763:Gmip UTSW 8 69817851 missense probably damaging 1.00
R6151:Gmip UTSW 8 69817085 missense probably damaging 1.00
R6163:Gmip UTSW 8 69817372 missense probably benign 0.28
R6228:Gmip UTSW 8 69816123 missense probably damaging 1.00
R6775:Gmip UTSW 8 69815635 missense possibly damaging 0.82
R6787:Gmip UTSW 8 69813786 missense probably damaging 1.00
R6788:Gmip UTSW 8 69811174 missense possibly damaging 0.87
R6788:Gmip UTSW 8 69811176 missense probably damaging 1.00
R6852:Gmip UTSW 8 69817991 nonsense probably null
R6934:Gmip UTSW 8 69820926 missense probably benign
R7010:Gmip UTSW 8 69811400 missense probably damaging 1.00
R7122:Gmip UTSW 8 69817802 missense probably benign 0.02
R7254:Gmip UTSW 8 69816468 intron probably null
R7351:Gmip UTSW 8 69817384 missense probably benign 0.01
R7360:Gmip UTSW 8 69811242 missense probably damaging 1.00
R7412:Gmip UTSW 8 69820499 missense probably benign
R7577:Gmip UTSW 8 69814435 missense probably benign 0.17
R7718:Gmip UTSW 8 69817733 missense probably damaging 0.99
X0063:Gmip UTSW 8 69809816 missense probably damaging 1.00
Z1176:Gmip UTSW 8 69816292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCCCCAGTCCTAGGATCTG -3'
(R):5'- GAATCCAAAGACCGGGACTC -3'

Sequencing Primer
(F):5'- TCTGGGGCTAGGACACTTAAG -3'
(R):5'- AAGACCGGGACTCACTGC -3'
Posted On2020-01-23