Mutagenetix > Incidental Mutations

Incidental Mutation 'R8018:Tdrd9'

617228

Institutional Source

Beutler Lab

Gene Symbol

Tdrd9

Ensembl Gene

ENSMUSG00000054003

Gene Name

tudor domain containing 9

Synonyms

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.279) question?

Stock #

R8018 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

111971559-112068854 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 112044388 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 1130 (R1130W)

Ref Sequence

ENSEMBL: ENSMUSP00000078022 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079009]

Predicted Effect

probably damaging
Transcript: ENSMUST00000079009
AA Change: R1130W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000078022
Gene: ENSMUSG00000054003
AA Change: R1130W

Domain	Start	End	E-Value	Type
low complexity region	29	40	N/A	INTRINSIC
low complexity region	70	81	N/A	INTRINSIC
DEXDc	132	327	5.64e-21	SMART
HELICc	404	502	3.22e-16	SMART
low complexity region	547	561	N/A	INTRINSIC
HA2	565	666	1.9e-20	SMART
TUDOR	944	1003	1.52e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000191808

Predicted Effect

probably benign
Transcript: ENSMUST00000192125

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Male homozygous mice are sterile, displaying small testis, arrest of male meiosis and abnormal spermatocyte morphology. Females are fertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563M21Rik	G	A	9: 55,973,707	T146I	unknown	Het
Abca16	A	G	7: 120,533,643	E1265G	probably benign	Het
Adar	T	C	3: 89,747,575	S924P	probably damaging	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
AI429214	A	T	8: 36,993,666		probably benign	Het
Ankmy1	A	T	1: 92,886,281	L392Q	probably benign	Het
Anxa3	A	T	5: 96,820,429	I114F	probably damaging	Het
Ccdc158	T	C	5: 92,623,401	D985G	possibly damaging	Het
Cndp2	C	T	18: 84,668,602	V432I	probably benign	Het
Ctbp2	T	C	7: 133,014,366	K280R	probably benign	Het
Dao	AGG	AG	5: 114,015,209		probably benign	Het
Dynap	T	C	18: 70,242,022	T41A	possibly damaging	Het
Elfn2	A	G	15: 78,673,768	L193P	probably damaging	Het
Fam129a	A	T	1: 151,717,255	K564*	probably null	Het
Fcrls	A	T	3: 87,259,626	L20*	probably null	Het
Flcn	T	C	11: 59,794,122	D501G	probably damaging	Het
Gm3147	T	C	5: 94,613,980	N244S	probably benign	Het
Gmip	A	G	8: 69,815,493	E399G	probably benign	Het
Grm7	A	G	6: 111,207,776	E356G	probably benign	Het
Hs3st2	A	G	7: 121,500,416		probably null	Het
Kcnh2	G	A	5: 24,320,016	S1158L	probably damaging	Het
Lancl2	A	G	6: 57,713,093	T104A	probably damaging	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Mthfd2l	T	A	5: 90,959,813	I178N	probably damaging	Het
Nipal3	C	T	4: 135,447,348	R364H	possibly damaging	Het
Olfr124	A	G	17: 37,805,147	M1V	probably null	Het
Oxa1l	A	G	14: 54,363,300	I77V	not run	Het
Phf10	T	A	17: 14,954,116	Q233H	possibly damaging	Het
Pias2	T	A	18: 77,128,958	N288K	probably benign	Het
Prm3	CTCTTCTTCTTCTTC	CTCTTCTTCTTC	16: 10,790,701		probably benign	Het
Ptprd	T	C	4: 76,085,520	T1010A	probably damaging	Het
Ralgapa2	T	C	2: 146,340,391	D1676G	probably damaging	Het
Rapgefl1	T	G	11: 98,840,340		probably null	Het
Rrp7a	C	T	15: 83,116,924	E269K	possibly damaging	Het
Ryr3	A	C	2: 112,678,432	M3399R	probably damaging	Het
Secisbp2l	C	A	2: 125,745,909	R762L	probably damaging	Het
Smad7	T	G	18: 75,369,284	L110R	possibly damaging	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Tia1	C	T	6: 86,425,052	P189S	probably benign	Het
Tubg1	G	T	11: 101,124,028	A199S	not run	Het
Ubxn8	A	G	8: 33,623,215	C204R	probably damaging	Het
Vmn1r76	A	G	7: 11,930,883	S135P	probably damaging	Het
Vps18	T	A	2: 119,294,011	L473H	probably damaging	Het
Zfp444	A	G	7: 6,188,143	T108A	probably benign	Het

Other mutations in Tdrd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01339:Tdrd9	APN	12	112040434	missense	probably damaging	1.00
IGL01373:Tdrd9	APN	12	112040434	missense	probably damaging	1.00
IGL01542:Tdrd9	APN	12	112046989	missense	possibly damaging	0.94
IGL02967:Tdrd9	APN	12	111992488	missense	possibly damaging	0.50
IGL03063:Tdrd9	APN	12	112044299	missense	probably benign	0.00
IGL03107:Tdrd9	APN	12	112042840	missense	probably damaging	0.98
R0433:Tdrd9	UTSW	12	112025581	nonsense	probably null
R0453:Tdrd9	UTSW	12	112068239	missense	probably benign
R0655:Tdrd9	UTSW	12	112040465	missense	probably damaging	1.00
R0666:Tdrd9	UTSW	12	112007580	intron	probably benign
R1073:Tdrd9	UTSW	12	112023259	missense	probably damaging	1.00
R1280:Tdrd9	UTSW	12	112039408	missense	probably damaging	1.00
R1386:Tdrd9	UTSW	12	112044804	missense	probably benign	0.21
R1521:Tdrd9	UTSW	12	112036410	missense	probably damaging	1.00
R1601:Tdrd9	UTSW	12	112023253	nonsense	probably null
R1651:Tdrd9	UTSW	12	112024706	missense	probably damaging	0.97
R1715:Tdrd9	UTSW	12	112036439	missense	possibly damaging	0.62
R1854:Tdrd9	UTSW	12	112044812	missense	probably damaging	1.00
R1905:Tdrd9	UTSW	12	112063627	splice site	probably benign
R2386:Tdrd9	UTSW	12	112015900	missense	probably damaging	1.00
R2863:Tdrd9	UTSW	12	112031261	missense	probably benign
R2915:Tdrd9	UTSW	12	112040461	missense	probably damaging	1.00
R2958:Tdrd9	UTSW	12	112041672	missense	probably damaging	0.97
R4033:Tdrd9	UTSW	12	111992539	missense	possibly damaging	0.58
R4087:Tdrd9	UTSW	12	112013486	nonsense	probably null
R4237:Tdrd9	UTSW	12	112067625	nonsense	probably null
R4482:Tdrd9	UTSW	12	112014501	critical splice donor site	probably null
R4501:Tdrd9	UTSW	12	112042809	missense	probably benign	0.00
R4502:Tdrd9	UTSW	12	111993825	missense	probably damaging	1.00
R4715:Tdrd9	UTSW	12	112041689	missense	probably benign	0.00
R4803:Tdrd9	UTSW	12	111996835	nonsense	probably null
R5218:Tdrd9	UTSW	12	112063475	intron	probably benign
R5275:Tdrd9	UTSW	12	112051912	nonsense	probably null
R5295:Tdrd9	UTSW	12	112051912	nonsense	probably null
R5301:Tdrd9	UTSW	12	112036529	critical splice donor site	probably null
R5339:Tdrd9	UTSW	12	112027122	missense	probably damaging	1.00
R5500:Tdrd9	UTSW	12	112023268	missense	probably benign	0.02
R5573:Tdrd9	UTSW	12	111997902	synonymous	probably null
R5590:Tdrd9	UTSW	12	112051980	missense	probably benign	0.01
R5891:Tdrd9	UTSW	12	112042719	missense	probably damaging	1.00
R6056:Tdrd9	UTSW	12	111985041	missense	probably damaging	1.00
R6057:Tdrd9	UTSW	12	112013286	missense	possibly damaging	0.85
R6125:Tdrd9	UTSW	12	112068198	missense	possibly damaging	0.89
R6254:Tdrd9	UTSW	12	112025900	splice site	probably null
R6335:Tdrd9	UTSW	12	112041752	critical splice donor site	probably null
R6345:Tdrd9	UTSW	12	112034608	missense	probably damaging	0.99
R6792:Tdrd9	UTSW	12	112027113	missense	probably benign	0.01
R6956:Tdrd9	UTSW	12	112036354	splice site	probably benign
R6987:Tdrd9	UTSW	12	112025593	missense	possibly damaging	0.82
R7090:Tdrd9	UTSW	12	111992470	missense	probably benign
R7158:Tdrd9	UTSW	12	112036366	missense	probably benign	0.08
R7220:Tdrd9	UTSW	12	112014454	missense	probably damaging	1.00
R7478:Tdrd9	UTSW	12	111985042	missense	probably damaging	1.00
R7489:Tdrd9	UTSW	12	112067637	missense	probably benign	0.00
R7751:Tdrd9	UTSW	12	111992548	missense	probably benign	0.09
R7809:Tdrd9	UTSW	12	112032721	missense	probably damaging	0.99
R7844:Tdrd9	UTSW	12	111997952	missense	possibly damaging	0.63
R7854:Tdrd9	UTSW	12	112046961	missense	probably benign	0.00
R7903:Tdrd9	UTSW	12	112051976	missense	possibly damaging	0.95
R7927:Tdrd9	UTSW	12	111997952	missense	possibly damaging	0.63
R7937:Tdrd9	UTSW	12	112046961	missense	probably benign	0.00
R7986:Tdrd9	UTSW	12	112051976	missense	possibly damaging	0.95
R8018:Tdrd9	UTSW	12	112032746	missense	probably benign	0.12
X0018:Tdrd9	UTSW	12	112039329	missense	probably benign	0.24
Z1177:Tdrd9	UTSW	12	111971654	missense	probably benign	0.08
Z1177:Tdrd9	UTSW	12	111993891	missense	probably damaging	0.96
Z1177:Tdrd9	UTSW	12	112015921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCCCTGCATATTCATGGC -3'
(R):5'- TTCCCCAGTGATGGACAGAAC -3'

Sequencing Primer
(F):5'- CTGCATATTCATGGCATTCAAATAGG -3'
(R):5'- CCCAGTGATGGACAGAACAACAG -3'

Posted On

2020-01-23