Incidental Mutation 'R8018:Phf10'
ID617235
Institutional Source Beutler Lab
Gene Symbol Phf10
Ensembl Gene ENSMUSG00000023883
Gene NamePHD finger protein 10
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location14945009-14961273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14954116 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 233 (Q233H)
Ref Sequence ENSEMBL: ENSMUSP00000024657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024657] [ENSMUST00000168938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024657
AA Change: Q233H

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024657
Gene: ENSMUSG00000023883
AA Change: Q233H

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
low complexity region 281 310 N/A INTRINSIC
PHD 378 433 1.22e-8 SMART
PHD 434 478 2.44e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168938
SMART Domains Protein: ENSMUSP00000125917
Gene: ENSMUSG00000023883

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
low complexity region 200 207 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Ccdc158 T C 5: 92,623,401 D985G possibly damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Gmip A G 8: 69,815,493 E399G probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Secisbp2l C A 2: 125,745,909 R762L probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tia1 C T 6: 86,425,052 P189S probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ubxn8 A G 8: 33,623,215 C204R probably damaging Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Phf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01418:Phf10 APN 17 14945134 missense probably benign 0.01
IGL01752:Phf10 APN 17 14954950 splice site probably benign
IGL02048:Phf10 APN 17 14945149 missense probably benign 0.00
IGL02334:Phf10 APN 17 14954099 missense probably damaging 0.99
IGL03177:Phf10 APN 17 14946231 missense probably damaging 1.00
R1562:Phf10 UTSW 17 14946250 missense probably damaging 1.00
R1913:Phf10 UTSW 17 14956809 missense probably benign 0.00
R2159:Phf10 UTSW 17 14952664 missense probably damaging 0.99
R4468:Phf10 UTSW 17 14952775 critical splice acceptor site probably null
R4498:Phf10 UTSW 17 14945115 missense probably benign 0.17
R5357:Phf10 UTSW 17 14954013 critical splice donor site probably null
R5865:Phf10 UTSW 17 14955010 intron probably benign
R6105:Phf10 UTSW 17 14954125 critical splice acceptor site probably null
R6522:Phf10 UTSW 17 14956007 missense probably damaging 1.00
R6663:Phf10 UTSW 17 14959512 missense probably null 0.05
R7203:Phf10 UTSW 17 14946313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTACACATCTTTTGGTGTCAC -3'
(R):5'- CTTCAGAGCCTGTGCACATG -3'

Sequencing Primer
(F):5'- CACATCTTTTGGTGTCACTGATAAAC -3'
(R):5'- CCTGTGCACATGGTGAATAAC -3'
Posted On2020-01-23