Incidental Mutation 'R8018:Ldlrad4'
ID617237
Institutional Source Beutler Lab
Gene Symbol Ldlrad4
Ensembl Gene ENSMUSG00000024544
Gene Namelow density lipoprotein receptor class A domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R8018 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67933257-68255549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 68235669 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 66 (A66S)
Ref Sequence ENSEMBL: ENSMUSP00000068471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063775
AA Change: A66S

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068471
Gene: ENSMUSG00000024544
AA Change: A66S

DomainStartEndE-ValueType
LDLa 14 49 3.69e-8 SMART
transmembrane domain 65 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik G A 9: 55,973,707 T146I unknown Het
Abca16 A G 7: 120,533,643 E1265G probably benign Het
Adar T C 3: 89,747,575 S924P probably damaging Het
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
AI429214 A T 8: 36,993,666 probably benign Het
Ankmy1 A T 1: 92,886,281 L392Q probably benign Het
Anxa3 A T 5: 96,820,429 I114F probably damaging Het
Ccdc158 T C 5: 92,623,401 D985G possibly damaging Het
Cndp2 C T 18: 84,668,602 V432I probably benign Het
Ctbp2 T C 7: 133,014,366 K280R probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Dynap T C 18: 70,242,022 T41A possibly damaging Het
Elfn2 A G 15: 78,673,768 L193P probably damaging Het
Fam129a A T 1: 151,717,255 K564* probably null Het
Fcrls A T 3: 87,259,626 L20* probably null Het
Flcn T C 11: 59,794,122 D501G probably damaging Het
Gm3147 T C 5: 94,613,980 N244S probably benign Het
Gmip A G 8: 69,815,493 E399G probably benign Het
Grm7 A G 6: 111,207,776 E356G probably benign Het
Hs3st2 A G 7: 121,500,416 probably null Het
Kcnh2 G A 5: 24,320,016 S1158L probably damaging Het
Lancl2 A G 6: 57,713,093 T104A probably damaging Het
Mthfd2l T A 5: 90,959,813 I178N probably damaging Het
Nipal3 C T 4: 135,447,348 R364H possibly damaging Het
Olfr124 A G 17: 37,805,147 M1V probably null Het
Oxa1l A G 14: 54,363,300 I77V not run Het
Phf10 T A 17: 14,954,116 Q233H possibly damaging Het
Pias2 T A 18: 77,128,958 N288K probably benign Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Ptprd T C 4: 76,085,520 T1010A probably damaging Het
Ralgapa2 T C 2: 146,340,391 D1676G probably damaging Het
Rapgefl1 T G 11: 98,840,340 probably null Het
Rrp7a C T 15: 83,116,924 E269K possibly damaging Het
Ryr3 A C 2: 112,678,432 M3399R probably damaging Het
Secisbp2l C A 2: 125,745,909 R762L probably damaging Het
Smad7 T G 18: 75,369,284 L110R possibly damaging Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tdrd9 T C 12: 112,032,746 V765A probably benign Het
Tdrd9 C T 12: 112,044,388 R1130W probably damaging Het
Tia1 C T 6: 86,425,052 P189S probably benign Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Ubxn8 A G 8: 33,623,215 C204R probably damaging Het
Vmn1r76 A G 7: 11,930,883 S135P probably damaging Het
Vps18 T A 2: 119,294,011 L473H probably damaging Het
Zfp444 A G 7: 6,188,143 T108A probably benign Het
Other mutations in Ldlrad4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02939:Ldlrad4 APN 18 68254514 missense probably damaging 1.00
IGL03140:Ldlrad4 APN 18 68254514 missense probably damaging 1.00
R1566:Ldlrad4 UTSW 18 68250598 missense probably benign
R1750:Ldlrad4 UTSW 18 68106687 missense probably benign 0.11
R6347:Ldlrad4 UTSW 18 68235780 missense probably benign 0.00
R7774:Ldlrad4 UTSW 18 68235792 nonsense probably null
R7775:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R7775:Ldlrad4 UTSW 18 68235756 missense probably damaging 1.00
R7777:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R7778:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R7812:Ldlrad4 UTSW 18 68106671 missense probably benign 0.07
R7827:Ldlrad4 UTSW 18 68254424 missense probably damaging 0.97
R8019:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
R8020:Ldlrad4 UTSW 18 68235669 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATGCAGCCGTTTTATGACTGC -3'
(R):5'- AAGTGGGCTATCCTACCCTC -3'

Sequencing Primer
(F):5'- GCAGCCGTTTTATGACTGCATTTTC -3'
(R):5'- TGCCACACCCTGTCTGG -3'
Posted On2020-01-23