Incidental Mutation 'R8019:Olfr1231'
ID617246
Institutional Source Beutler Lab
Gene Symbol Olfr1231
Ensembl Gene ENSMUSG00000075093
Gene Nameolfactory receptor 1231
SynonymsGA_x6K02T2Q125-50748233-50747292, MOR235-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R8019 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89299786-89307074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89303251 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 114 (I114F)
Ref Sequence ENSEMBL: ENSMUSP00000150310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099786] [ENSMUST00000216144]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099786
AA Change: I114F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097374
Gene: ENSMUSG00000075093
AA Change: I114F

DomainStartEndE-ValueType
Pfam:7tm_4 32 306 7e-43 PFAM
Pfam:7tm_1 42 288 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216144
AA Change: I114F

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,850,676 A51E unknown Het
A2ml1 C T 6: 128,581,447 probably null Het
Aimp2 G A 5: 143,909,594 A41V probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
BC067074 T A 13: 113,319,623 S734R Het
Bnc2 A G 4: 84,411,425 L118P Het
Ccdc18 T A 5: 108,228,645 Y1317* probably null Het
Ccdc93 C T 1: 121,448,264 T168M probably damaging Het
Cd109 G T 9: 78,707,546 D1292Y possibly damaging Het
Cdh24 G T 14: 54,638,632 N184K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Efemp2 T A 19: 5,477,680 C181* probably null Het
Eftud2 A G 11: 102,843,348 probably null Het
Elp2 G A 18: 24,606,863 V49M possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exph5 G A 9: 53,373,452 C611Y probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm9376 T G 14: 118,267,539 Y128D probably damaging Het
Gsdmc2 T A 15: 63,826,913 N278I probably benign Het
Hace1 C T 10: 45,638,382 T199M probably damaging Het
Hivep1 T C 13: 42,167,622 V44A Het
Homez A C 14: 54,858,232 D6E probably benign Het
Ighv5-12 A T 12: 113,702,172 M102K probably damaging Het
Jup T C 11: 100,374,197 T643A probably benign Het
Kif17 G A 4: 138,296,225 R927Q probably benign Het
Krt4 T A 15: 101,920,287 I381F probably damaging Het
Krt6a A G 15: 101,693,869 V127A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mgea5 A T 19: 45,773,668 W249R probably damaging Het
Mtfr2 A T 10: 20,354,154 N153Y probably damaging Het
Npas3 G A 12: 54,044,679 V339I probably damaging Het
Nsun2 C T 13: 69,627,645 R438C probably damaging Het
Olfr1140 T A 2: 87,747,048 M284K probably damaging Het
Olfr1297 A C 2: 111,622,067 D2E probably benign Het
Pdzd2 T C 15: 12,373,036 R2338G probably damaging Het
Pgm2 A G 4: 99,986,678 M553V probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Ppp2r5e A G 12: 75,464,929 I340T probably damaging Het
Qprt C A 7: 127,108,824 R145L probably damaging Het
Sertad4 T C 1: 192,846,521 D329G probably benign Het
Setd2 C T 9: 110,602,187 T583M Het
Slc12a7 T C 13: 73,799,720 I652T probably damaging Het
Slc27a5 T C 7: 12,989,402 D539G probably damaging Het
Slc36a2 A G 11: 55,164,269 I320T probably benign Het
Slc6a20a A G 9: 123,637,852 Y524H probably damaging Het
Slc6a20a T A 9: 123,664,574 S81C probably damaging Het
Srf G T 17: 46,555,822 P3T unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stag3 T C 5: 138,301,203 M828T possibly damaging Het
Stk36 T C 1: 74,612,766 V406A probably benign Het
Svep1 G T 4: 58,146,637 P335Q probably damaging Het
Svs5 T A 2: 164,333,421 S64R possibly damaging Het
Taf2 A G 15: 55,064,617 V130A possibly damaging Het
Tbrg4 C T 11: 6,618,517 V421M probably damaging Het
Tbx4 G T 11: 85,914,160 K358N probably damaging Het
Tenm4 A T 7: 96,704,041 T384S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Vmn1r159 A T 7: 22,842,823 H261Q probably benign Het
Zfp574 T A 7: 25,080,670 C372* probably null Het
Other mutations in Olfr1231
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Olfr1231 APN 2 89303472 missense possibly damaging 0.90
IGL02189:Olfr1231 APN 2 89303297 missense probably damaging 1.00
IGL02354:Olfr1231 APN 2 89303182 missense probably benign 0.03
IGL02361:Olfr1231 APN 2 89303182 missense probably benign 0.03
PIT4305001:Olfr1231 UTSW 2 89303383 missense probably benign 0.05
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0973:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R0974:Olfr1231 UTSW 2 89303184 missense probably damaging 1.00
R2006:Olfr1231 UTSW 2 89302816 missense possibly damaging 0.60
R3150:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3177:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3277:Olfr1231 UTSW 2 89303218 missense possibly damaging 0.82
R3409:Olfr1231 UTSW 2 89303373 missense probably benign
R4208:Olfr1231 UTSW 2 89302926 missense probably damaging 1.00
R4412:Olfr1231 UTSW 2 89303340 missense probably benign 0.00
R4693:Olfr1231 UTSW 2 89303277 missense probably benign 0.07
R4697:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.90
R4697:Olfr1231 UTSW 2 89302903 missense probably damaging 1.00
R5411:Olfr1231 UTSW 2 89303576 missense probably benign
R5992:Olfr1231 UTSW 2 89303359 missense possibly damaging 0.50
R6894:Olfr1231 UTSW 2 89303493 missense probably damaging 1.00
R8017:Olfr1231 UTSW 2 89303251 missense possibly damaging 0.94
X0064:Olfr1231 UTSW 2 89302902 missense possibly damaging 0.72
X0067:Olfr1231 UTSW 2 89303154 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GTGGTCAATGACATTGGGGC -3'
(R):5'- GTTGGCTAATCTGCTCATTGTC -3'

Sequencing Primer
(F):5'- TCAATGACATTGGGGCCACAG -3'
(R):5'- GGCTAATCTGCTCATTGTCCTCAC -3'
Posted On2020-01-23