Mutagenetix > Incidental Mutation

Incidental Mutation 'R8019:Cd109'

617267

Institutional Source

Beutler Lab

Gene Symbol

Cd109

Ensembl Gene

ENSMUSG00000046186

Gene Name

CD109 antigen

Synonyms

Gov platelet alloantigens, 9930012E15Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8019 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78615546-78716253 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 78707546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 1292 (D1292Y)

Ref Sequence

ENSEMBL: ENSMUSP00000091330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093812]

AlphaFold

Q8R422

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093812
AA Change: D1292Y

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186
AA Change: D1292Y

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:A2M_N	129	220	1.5e-16	PFAM
A2M_N_2	470	601	8.89e-32	SMART
A2M	695	786	2.07e-32	SMART
Pfam:Thiol-ester_cl	912	941	2.6e-20	PFAM
Pfam:A2M_comp	961	1197	1.9e-65	PFAM
low complexity region	1265	1275	N/A	INTRINSIC
A2M_recep	1311	1395	2.06e-27	SMART
low complexity region	1422	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	G	T	4: 124,850,676	A51E	unknown	Het
A2ml1	C	T	6: 128,581,447		probably null	Het
Aimp2	G	A	5: 143,909,594	A41V	probably benign	Het
Amotl2	C	T	9: 102,723,769	T345I	probably benign	Het
BC067074	T	A	13: 113,319,623	S734R		Het
Bnc2	A	G	4: 84,411,425	L118P		Het
Ccdc18	T	A	5: 108,228,645	Y1317*	probably null	Het
Ccdc93	C	T	1: 121,448,264	T168M	probably damaging	Het
Cdh24	G	T	14: 54,638,632	N184K	probably damaging	Het
Clpsl2	G	A	17: 28,550,728	G55R	probably damaging	Het
Efemp2	T	A	19: 5,477,680	C181*	probably null	Het
Eftud2	A	G	11: 102,843,348		probably null	Het
Elp2	G	A	18: 24,606,863	V49M	possibly damaging	Het
Evl	C	T	12: 108,681,524	R295*	probably null	Het
Exph5	G	A	9: 53,373,452	C611Y	probably benign	Het
Gm10800	A	AC	2: 98,667,033		probably null	Het
Gm9376	T	G	14: 118,267,539	Y128D	probably damaging	Het
Gsdmc2	T	A	15: 63,826,913	N278I	probably benign	Het
Hace1	C	T	10: 45,638,382	T199M	probably damaging	Het
Hivep1	T	C	13: 42,167,622	V44A		Het
Homez	A	C	14: 54,858,232	D6E	probably benign	Het
Ighv5-12	A	T	12: 113,702,172	M102K	probably damaging	Het
Jup	T	C	11: 100,374,197	T643A	probably benign	Het
Kif17	G	A	4: 138,296,225	R927Q	probably benign	Het
Krt4	T	A	15: 101,920,287	I381F	probably damaging	Het
Krt6a	A	G	15: 101,693,869	V127A	probably damaging	Het
Ldlrad4	G	T	18: 68,235,669	A66S	possibly damaging	Het
Mgea5	A	T	19: 45,773,668	W249R	probably damaging	Het
Mtfr2	A	T	10: 20,354,154	N153Y	probably damaging	Het
Npas3	G	A	12: 54,044,679	V339I	probably damaging	Het
Nsun2	C	T	13: 69,627,645	R438C	probably damaging	Het
Olfr1140	T	A	2: 87,747,048	M284K	probably damaging	Het
Olfr1231	T	A	2: 89,303,251	I114F	possibly damaging	Het
Olfr1297	A	C	2: 111,622,067	D2E	probably benign	Het
Pdzd2	T	C	15: 12,373,036	R2338G	probably damaging	Het
Pgm2	A	G	4: 99,986,678	M553V	probably benign	Het
Pigt	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT	2: 164,499,669		probably null	Het
Pira2	A	T	7: 3,841,697	F445Y	probably benign	Het
Ppp2r5e	A	G	12: 75,464,929	I340T	probably damaging	Het
Qprt	C	A	7: 127,108,824	R145L	probably damaging	Het
Sertad4	T	C	1: 192,846,521	D329G	probably benign	Het
Setd2	C	T	9: 110,602,187	T583M		Het
Slc12a7	T	C	13: 73,799,720	I652T	probably damaging	Het
Slc27a5	T	C	7: 12,989,402	D539G	probably damaging	Het
Slc36a2	A	G	11: 55,164,269	I320T	probably benign	Het
Slc6a20a	A	G	9: 123,637,852	Y524H	probably damaging	Het
Slc6a20a	T	A	9: 123,664,574	S81C	probably damaging	Het
Srf	G	T	17: 46,555,822	P3T	unknown	Het
St6gal1	G	A	16: 23,357,835	A393T	probably benign	Het
Stag3	T	C	5: 138,301,203	M828T	possibly damaging	Het
Stk36	T	C	1: 74,612,766	V406A	probably benign	Het
Svep1	G	T	4: 58,146,637	P335Q	probably damaging	Het
Svs5	T	A	2: 164,333,421	S64R	possibly damaging	Het
Taf2	A	G	15: 55,064,617	V130A	possibly damaging	Het
Tbrg4	C	T	11: 6,618,517	V421M	probably damaging	Het
Tbx4	G	T	11: 85,914,160	K358N	probably damaging	Het
Tenm4	A	T	7: 96,704,041	T384S	probably damaging	Het
Tubg1	G	T	11: 101,124,028	A199S	probably benign	Het
Vmn1r159	A	T	7: 22,842,823	H261Q	probably benign	Het
Zfp574	T	A	7: 25,080,670	C372*	probably null	Het

Other mutations in Cd109

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cd109	APN	9	78616969	missense	probably damaging	1.00
IGL00465:Cd109	APN	9	78660934	nonsense	probably null
IGL00667:Cd109	APN	9	78684877	missense	probably damaging	0.99
IGL01432:Cd109	APN	9	78698123	missense	probably benign
IGL01795:Cd109	APN	9	78661765	splice site	probably benign
IGL02343:Cd109	APN	9	78688955	splice site	probably benign
IGL02450:Cd109	APN	9	78695850	missense	possibly damaging	0.83
IGL02699:Cd109	APN	9	78671989	splice site	probably benign
IGL02738:Cd109	APN	9	78691299	missense	probably damaging	1.00
IGL02797:Cd109	APN	9	78661713	missense	probably damaging	0.96
IGL03160:Cd109	APN	9	78661056	splice site	probably null
IGL03349:Cd109	APN	9	78636485	missense	probably benign	0.34
FR4589:Cd109	UTSW	9	78712529	critical splice acceptor site	probably benign
R0048:Cd109	UTSW	9	78680021	missense	possibly damaging	0.50
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0060:Cd109	UTSW	9	78703107	missense	probably damaging	1.00
R0158:Cd109	UTSW	9	78688932	missense	possibly damaging	0.49
R0415:Cd109	UTSW	9	78712615	missense	probably benign	0.13
R0659:Cd109	UTSW	9	78680170	splice site	probably benign
R0709:Cd109	UTSW	9	78671978	missense	possibly damaging	0.93
R0840:Cd109	UTSW	9	78664330	missense	probably benign	0.04
R0909:Cd109	UTSW	9	78636473	missense	probably benign	0.01
R0945:Cd109	UTSW	9	78688941	missense	possibly damaging	0.51
R1344:Cd109	UTSW	9	78672550	critical splice acceptor site	probably null
R1471:Cd109	UTSW	9	78654587	missense	probably damaging	1.00
R1484:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1570:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R1688:Cd109	UTSW	9	78705091	missense	probably benign	0.17
R1773:Cd109	UTSW	9	78703724	missense	probably benign	0.21
R1813:Cd109	UTSW	9	78617005	missense	probably benign	0.04
R2004:Cd109	UTSW	9	78703762	missense	probably benign	0.00
R2083:Cd109	UTSW	9	78667293	missense	probably damaging	1.00
R2483:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R2857:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2858:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2859:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2911:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2912:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2914:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R2927:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3623:Cd109	UTSW	9	78667357	missense	probably damaging	1.00
R3713:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3760:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3762:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3771:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3772:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3916:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R3917:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4117:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4260:Cd109	UTSW	9	78636463	missense	possibly damaging	0.67
R4387:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4389:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4526:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4527:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4528:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4700:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4708:Cd109	UTSW	9	78672589	missense	probably benign	0.00
R4723:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4750:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4751:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4754:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4755:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4773:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R4984:Cd109	UTSW	9	78634677	critical splice donor site	probably null
R5259:Cd109	UTSW	9	78710152	missense	probably benign	0.30
R5353:Cd109	UTSW	9	78710239	missense	probably damaging	1.00
R5440:Cd109	UTSW	9	78680164	critical splice donor site	probably null
R5559:Cd109	UTSW	9	78660968	missense	probably benign	0.01
R5701:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R5995:Cd109	UTSW	9	78700279	missense	probably benign	0.01
R5997:Cd109	UTSW	9	78705062	missense	possibly damaging	0.93
R6103:Cd109	UTSW	9	78698314	splice site	probably null
R6174:Cd109	UTSW	9	78665546	critical splice donor site	probably null
R6410:Cd109	UTSW	9	78657516	missense	probably benign	0.01
R6529:Cd109	UTSW	9	78712625	missense	probably damaging	1.00
R6655:Cd109	UTSW	9	78684938	missense	probably benign	0.44
R6704:Cd109	UTSW	9	78680075	missense	probably benign	0.01
R6772:Cd109	UTSW	9	78680810	missense	possibly damaging	0.55
R6817:Cd109	UTSW	9	78714955	missense	probably benign	0.01
R6903:Cd109	UTSW	9	78636603	missense	probably damaging	0.97
R7294:Cd109	UTSW	9	78712635	missense	probably damaging	0.97
R7432:Cd109	UTSW	9	78714943	missense	possibly damaging	0.85
R7566:Cd109	UTSW	9	78680837	missense	probably damaging	1.00
R7767:Cd109	UTSW	9	78710159	missense	probably damaging	1.00
R7986:Cd109	UTSW	9	78688766	missense	possibly damaging	0.95
R8017:Cd109	UTSW	9	78707546	missense	possibly damaging	0.81
R8050:Cd109	UTSW	9	78664351	missense	probably benign	0.28
R8225:Cd109	UTSW	9	78661690	missense	probably damaging	0.99
R8269:Cd109	UTSW	9	78665682	missense	probably benign	0.06
R8479:Cd109	UTSW	9	78667346	nonsense	probably null
R8493:Cd109	UTSW	9	78657519	missense	probably benign	0.41
R8781:Cd109	UTSW	9	78636647	missense	probably damaging	1.00
R8977:Cd109	UTSW	9	78707528	missense	probably benign	0.36
R9051:Cd109	UTSW	9	78712500	critical splice acceptor site	probably benign
R9051:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
R9228:Cd109	UTSW	9	78669760	missense	possibly damaging	0.93
R9366:Cd109	UTSW	9	78714993	missense	probably benign	0.11
R9430:Cd109	UTSW	9	78667416	critical splice donor site	probably null
R9572:Cd109	UTSW	9	78660306	missense	probably benign	0.16
R9691:Cd109	UTSW	9	78703792	missense	possibly damaging	0.94
R9736:Cd109	UTSW	9	78712636	missense	probably damaging	1.00
R9749:Cd109	UTSW	9	78684884	missense	probably damaging	1.00
R9751:Cd109	UTSW	9	78698160	missense	probably damaging	0.99
R9752:Cd109	UTSW	9	78707552	missense	probably benign	0.00
R9789:Cd109	UTSW	9	78634662	missense	possibly damaging	0.90
R9797:Cd109	UTSW	9	78671935	missense	probably benign	0.04
RF002:Cd109	UTSW	9	78712523	critical splice acceptor site	probably benign
RF002:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF003:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF011:Cd109	UTSW	9	78712528	critical splice acceptor site	probably benign
RF013:Cd109	UTSW	9	78712531	critical splice acceptor site	probably benign
RF047:Cd109	UTSW	9	78712527	critical splice acceptor site	probably benign
RF060:Cd109	UTSW	9	78712525	critical splice acceptor site	probably benign
Z1177:Cd109	UTSW	9	78691313	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TGCTCTGACATTACTTTGGTGTATC -3'
(R):5'- CTTGTATGAAATCTGTGGAGCAC -3'

Sequencing Primer
(F):5'- GTGGTTTAATAAAGAGGTAGCCATC -3'
(R):5'- TCTGTGGAGCACTGATAAAAGAAATC -3'

Posted On

2020-01-23