Incidental Mutation 'R8019:Slc12a7'
ID 617286
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Name solute carrier family 12, member 7
Synonyms Kcc4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8019 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 73733094-73816754 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73799720 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 652 (I652T)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900]
AlphaFold Q9WVL3
Predicted Effect probably damaging
Transcript: ENSMUST00000017900
AA Change: I652T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: I652T

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,850,676 A51E unknown Het
A2ml1 C T 6: 128,581,447 probably null Het
Aimp2 G A 5: 143,909,594 A41V probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
BC067074 T A 13: 113,319,623 S734R Het
Bnc2 A G 4: 84,411,425 L118P Het
Ccdc18 T A 5: 108,228,645 Y1317* probably null Het
Ccdc93 C T 1: 121,448,264 T168M probably damaging Het
Cd109 G T 9: 78,707,546 D1292Y possibly damaging Het
Cdh24 G T 14: 54,638,632 N184K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Efemp2 T A 19: 5,477,680 C181* probably null Het
Eftud2 A G 11: 102,843,348 probably null Het
Elp2 G A 18: 24,606,863 V49M possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exph5 G A 9: 53,373,452 C611Y probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm9376 T G 14: 118,267,539 Y128D probably damaging Het
Gsdmc2 T A 15: 63,826,913 N278I probably benign Het
Hace1 C T 10: 45,638,382 T199M probably damaging Het
Hivep1 T C 13: 42,167,622 V44A Het
Homez A C 14: 54,858,232 D6E probably benign Het
Ighv5-12 A T 12: 113,702,172 M102K probably damaging Het
Jup T C 11: 100,374,197 T643A probably benign Het
Kif17 G A 4: 138,296,225 R927Q probably benign Het
Krt4 T A 15: 101,920,287 I381F probably damaging Het
Krt6a A G 15: 101,693,869 V127A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mgea5 A T 19: 45,773,668 W249R probably damaging Het
Mtfr2 A T 10: 20,354,154 N153Y probably damaging Het
Npas3 G A 12: 54,044,679 V339I probably damaging Het
Nsun2 C T 13: 69,627,645 R438C probably damaging Het
Olfr1140 T A 2: 87,747,048 M284K probably damaging Het
Olfr1231 T A 2: 89,303,251 I114F possibly damaging Het
Olfr1297 A C 2: 111,622,067 D2E probably benign Het
Pdzd2 T C 15: 12,373,036 R2338G probably damaging Het
Pgm2 A G 4: 99,986,678 M553V probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Ppp2r5e A G 12: 75,464,929 I340T probably damaging Het
Qprt C A 7: 127,108,824 R145L probably damaging Het
Sertad4 T C 1: 192,846,521 D329G probably benign Het
Setd2 C T 9: 110,602,187 T583M Het
Slc27a5 T C 7: 12,989,402 D539G probably damaging Het
Slc36a2 A G 11: 55,164,269 I320T probably benign Het
Slc6a20a A G 9: 123,637,852 Y524H probably damaging Het
Slc6a20a T A 9: 123,664,574 S81C probably damaging Het
Srf G T 17: 46,555,822 P3T unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stag3 T C 5: 138,301,203 M828T possibly damaging Het
Stk36 T C 1: 74,612,766 V406A probably benign Het
Svep1 G T 4: 58,146,637 P335Q probably damaging Het
Svs5 T A 2: 164,333,421 S64R possibly damaging Het
Taf2 A G 15: 55,064,617 V130A possibly damaging Het
Tbrg4 C T 11: 6,618,517 V421M probably damaging Het
Tbx4 G T 11: 85,914,160 K358N probably damaging Het
Tenm4 A T 7: 96,704,041 T384S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S probably benign Het
Vmn1r159 A T 7: 22,842,823 H261Q probably benign Het
Zfp574 T A 7: 25,080,670 C372* probably null Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73794082 missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73814843 missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73792737 missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73799614 missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73809094 critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73797703 critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73795595 unclassified probably benign
IGL02422:Slc12a7 APN 13 73806161 missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73763763 utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73785123 missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73809087 missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73813676 unclassified probably benign
IGL02868:Slc12a7 APN 13 73806388 missense probably benign
R0828:Slc12a7 UTSW 13 73788652 missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73801008 missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73790671 missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73795113 missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73785155 nonsense probably null
R3023:Slc12a7 UTSW 13 73800422 missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73809923 missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73814843 missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73790734 missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73813589 missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73763892 critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73763777 missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73805433 missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73785139 missense probably benign
R5760:Slc12a7 UTSW 13 73813622 missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73793940 missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73805471 missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73797537 missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73798969 missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73784560 missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73763962 intron probably benign
R7458:Slc12a7 UTSW 13 73785069 missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73764068 intron probably benign
R7565:Slc12a7 UTSW 13 73790772 missense possibly damaging 0.58
R7660:Slc12a7 UTSW 13 73806089 missense probably benign
R7737:Slc12a7 UTSW 13 73788677 missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73805469 missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73788604 missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73799720 missense probably damaging 1.00
R8281:Slc12a7 UTSW 13 73790677 missense probably damaging 1.00
R8342:Slc12a7 UTSW 13 73785162 missense probably benign
R8747:Slc12a7 UTSW 13 73785122 missense probably benign 0.30
R8920:Slc12a7 UTSW 13 73798449 missense probably damaging 1.00
R9292:Slc12a7 UTSW 13 73784588 missense possibly damaging 0.46
R9381:Slc12a7 UTSW 13 73800944 missense probably benign 0.00
R9400:Slc12a7 UTSW 13 73784570 missense probably benign 0.00
X0023:Slc12a7 UTSW 13 73788608 missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73798541 splice site probably null
X0065:Slc12a7 UTSW 13 73800945 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCTGATGCTCTGTTCAAGG -3'
(R):5'- GAATTCAGCATATACCCGAGTACG -3'

Sequencing Primer
(F):5'- CTGATGCTCTGTTCAAGGAAGAG -3'
(R):5'- TATACCCGAGTACGTCAGCCTG -3'
Posted On 2020-01-23