Incidental Mutation 'R8019:Krt4'
ID617295
Institutional Source Beutler Lab
Gene Symbol Krt4
Ensembl Gene ENSMUSG00000059668
Gene Namekeratin 4
SynonymsKrt-2.4, K4, Krt2-4
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R8019 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101918535-101924735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101920287 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 381 (I381F)
Ref Sequence ENSEMBL: ENSMUSP00000023797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023797]
Predicted Effect probably damaging
Transcript: ENSMUST00000023797
AA Change: I381F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023797
Gene: ENSMUSG00000059668
AA Change: I381F

DomainStartEndE-ValueType
Pfam:Keratin_2_head 14 142 4.7e-37 PFAM
Filament 145 458 1.61e-166 SMART
low complexity region 465 511 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display hyperplasia throughout the epithelium of the esophagus and tongue. Mice homozygous or heterozygous for a dominant mutation display oral leukoplakia and homozygotes display postnatal growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik G T 4: 124,850,676 A51E unknown Het
A2ml1 C T 6: 128,581,447 probably null Het
Aimp2 G A 5: 143,909,594 A41V probably benign Het
Amotl2 C T 9: 102,723,769 T345I probably benign Het
BC067074 T A 13: 113,319,623 S734R Het
Bnc2 A G 4: 84,411,425 L118P Het
Ccdc18 T A 5: 108,228,645 Y1317* probably null Het
Ccdc93 C T 1: 121,448,264 T168M probably damaging Het
Cd109 G T 9: 78,707,546 D1292Y possibly damaging Het
Cdh24 G T 14: 54,638,632 N184K probably damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Efemp2 T A 19: 5,477,680 C181* probably null Het
Eftud2 A G 11: 102,843,348 probably null Het
Elp2 G A 18: 24,606,863 V49M possibly damaging Het
Evl C T 12: 108,681,524 R295* probably null Het
Exph5 G A 9: 53,373,452 C611Y probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm9376 T G 14: 118,267,539 Y128D probably damaging Het
Gsdmc2 T A 15: 63,826,913 N278I probably benign Het
Hace1 C T 10: 45,638,382 T199M probably damaging Het
Hivep1 T C 13: 42,167,622 V44A Het
Homez A C 14: 54,858,232 D6E probably benign Het
Ighv5-12 A T 12: 113,702,172 M102K probably damaging Het
Jup T C 11: 100,374,197 T643A probably benign Het
Kif17 G A 4: 138,296,225 R927Q probably benign Het
Krt6a A G 15: 101,693,869 V127A probably damaging Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Mgea5 A T 19: 45,773,668 W249R probably damaging Het
Mtfr2 A T 10: 20,354,154 N153Y probably damaging Het
Npas3 G A 12: 54,044,679 V339I probably damaging Het
Nsun2 C T 13: 69,627,645 R438C probably damaging Het
Olfr1140 T A 2: 87,747,048 M284K probably damaging Het
Olfr1231 T A 2: 89,303,251 I114F possibly damaging Het
Olfr1297 A C 2: 111,622,067 D2E probably benign Het
Pdzd2 T C 15: 12,373,036 R2338G probably damaging Het
Pgm2 A G 4: 99,986,678 M553V probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pira2 A T 7: 3,841,697 F445Y not run Het
Ppp2r5e A G 12: 75,464,929 I340T probably damaging Het
Qprt C A 7: 127,108,824 R145L probably damaging Het
Sertad4 T C 1: 192,846,521 D329G probably benign Het
Setd2 C T 9: 110,602,187 T583M Het
Slc12a7 T C 13: 73,799,720 I652T probably damaging Het
Slc27a5 T C 7: 12,989,402 D539G probably damaging Het
Slc36a2 A G 11: 55,164,269 I320T probably benign Het
Slc6a20a A G 9: 123,637,852 Y524H probably damaging Het
Slc6a20a T A 9: 123,664,574 S81C probably damaging Het
Srf G T 17: 46,555,822 P3T unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Stag3 T C 5: 138,301,203 M828T possibly damaging Het
Stk36 T C 1: 74,612,766 V406A probably benign Het
Svep1 G T 4: 58,146,637 P335Q probably damaging Het
Svs5 T A 2: 164,333,421 S64R possibly damaging Het
Taf2 A G 15: 55,064,617 V130A possibly damaging Het
Tbrg4 C T 11: 6,618,517 V421M probably damaging Het
Tbx4 G T 11: 85,914,160 K358N probably damaging Het
Tenm4 A T 7: 96,704,041 T384S probably damaging Het
Tubg1 G T 11: 101,124,028 A199S not run Het
Vmn1r159 A T 7: 22,842,823 H261Q probably benign Het
Zfp574 T A 7: 25,080,670 C372* probably null Het
Other mutations in Krt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Krt4 APN 15 101920281 missense probably damaging 1.00
IGL02306:Krt4 APN 15 101921305 missense probably benign 0.13
IGL02407:Krt4 APN 15 101921305 missense probably benign 0.13
IGL02504:Krt4 APN 15 101919292 missense unknown
R0042:Krt4 UTSW 15 101922752 splice site probably benign
R0042:Krt4 UTSW 15 101922752 splice site probably benign
R0211:Krt4 UTSW 15 101922782 missense possibly damaging 0.80
R0363:Krt4 UTSW 15 101924646 missense possibly damaging 0.91
R2018:Krt4 UTSW 15 101920651 missense probably damaging 1.00
R2067:Krt4 UTSW 15 101924664 missense possibly damaging 0.70
R2571:Krt4 UTSW 15 101921257 missense probably damaging 1.00
R3943:Krt4 UTSW 15 101921250 missense probably benign 0.00
R3944:Krt4 UTSW 15 101921250 missense probably benign 0.00
R5104:Krt4 UTSW 15 101920323 missense probably damaging 1.00
R5107:Krt4 UTSW 15 101922791 missense possibly damaging 0.89
R5579:Krt4 UTSW 15 101921234 missense probably benign 0.01
R6052:Krt4 UTSW 15 101922759 critical splice donor site probably null
R6429:Krt4 UTSW 15 101922794 missense probably benign 0.00
R7371:Krt4 UTSW 15 101920388 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCATTCCTTCCAGACAG -3'
(R):5'- ACTGGCTATCACTTCACCGG -3'

Sequencing Primer
(F):5'- TGCCCCTGCAAGACTGC -3'
(R):5'- ATCACTTCACCGGGGGATTTCATG -3'
Posted On2020-01-23