Incidental Mutation 'R0679:Sox10'
ID61731
Institutional Source Beutler Lab
Gene Symbol Sox10
Ensembl Gene ENSMUSG00000033006
Gene NameSRY (sex determining region Y)-box 10
SynonymsSox21
MMRRC Submission 038864-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0679 (G1)
Quality Score150
Status Not validated
Chromosome15
Chromosomal Location79154908-79165240 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79156588 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 90 (S90P)
Ref Sequence ENSEMBL: ENSMUSP00000155639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040019] [ENSMUST00000040077] [ENSMUST00000229973] [ENSMUST00000230261] [ENSMUST00000230271] [ENSMUST00000230532]
Predicted Effect probably benign
Transcript: ENSMUST00000040019
AA Change: S251P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039466
Gene: ENSMUSG00000033006
AA Change: S251P

DomainStartEndE-ValueType
Pfam:Sox_N 12 93 1.8e-31 PFAM
HMG 103 173 8.16e-27 SMART
low complexity region 183 205 N/A INTRINSIC
low complexity region 238 245 N/A INTRINSIC
low complexity region 310 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040077
SMART Domains Protein: ENSMUSP00000043566
Gene: ENSMUSG00000033020

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
Pfam:RNA_pol_Rpb6 51 104 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229762
Predicted Effect probably benign
Transcript: ENSMUST00000229973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229978
Predicted Effect probably benign
Transcript: ENSMUST00000230261
AA Change: S90P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000230271
Predicted Effect probably benign
Transcript: ENSMUST00000230532
AA Change: S251P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional activator after forming a protein complex with other proteins. This protein acts as a nucleocytoplasmic shuttle protein and is important for neural crest and peripheral nervous system development. Mutations in this gene are associated with Waardenburg-Shah and Waardenburg-Hirschsprung disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations lack peripheral glial cells, melanocytes, and autonomic and enteric neurons, and die neonatally or sooner. Heterozygotes exhibit white spotting and megacolon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,223,122 V1943L probably benign Het
Adgrl3 G A 5: 81,794,977 D1507N probably damaging Het
Cry2 A G 2: 92,413,715 I371T probably damaging Het
L3mbtl3 T A 10: 26,313,933 K478* probably null Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Plcg1 C T 2: 160,756,910 P842S probably damaging Het
Ros1 T C 10: 52,066,295 R2111G possibly damaging Het
Tbc1d32 A C 10: 56,180,576 Y423D probably damaging Het
Utp15 A T 13: 98,259,403 Y52N probably benign Het
Vps13b T G 15: 35,709,703 I1932S possibly damaging Het
Zfp457 A T 13: 67,293,591 C211S probably damaging Het
Other mutations in Sox10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Sox10 APN 15 79156339 missense probably benign 0.24
IGL01693:Sox10 APN 15 79156273 missense possibly damaging 0.85
IGL02137:Sox10 APN 15 79159193 missense probably benign 0.01
Dalmatian UTSW 15 79163324 missense probably damaging 1.00
Kat UTSW 15 79163319 missense probably damaging 1.00
R0479:Sox10 UTSW 15 79163319 missense probably damaging 1.00
R0589:Sox10 UTSW 15 79163285 splice site probably benign
R0624:Sox10 UTSW 15 79159386 missense possibly damaging 0.90
R0835:Sox10 UTSW 15 79156441 missense probably damaging 1.00
R1517:Sox10 UTSW 15 79159178 missense probably benign 0.00
R1635:Sox10 UTSW 15 79156460 missense probably damaging 1.00
R4089:Sox10 UTSW 15 79156363 missense possibly damaging 0.90
R5533:Sox10 UTSW 15 79156302 missense probably benign 0.08
R5883:Sox10 UTSW 15 79156263 missense probably damaging 1.00
R6742:Sox10 UTSW 15 79156476 missense probably damaging 1.00
R7457:Sox10 UTSW 15 79156139 missense probably benign 0.06
R7514:Sox10 UTSW 15 79156221 missense probably benign 0.01
X0062:Sox10 UTSW 15 79156030 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGGTCCAGCTCAGTCACATCAAAG -3'
(R):5'- TGCCTGACAATTAGCAGTGCCC -3'

Sequencing Primer
(F):5'- GCTCAGTCACATCAAAGGTTTC -3'
(R):5'- gccctgtgcatttgctg -3'
Posted On2013-07-30