Incidental Mutation 'R8020:Gng11'
ID617315
Institutional Source Beutler Lab
Gene Symbol Gng11
Ensembl Gene ENSMUSG00000032766
Gene Nameguanine nucleotide binding protein (G protein), gamma 11
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8020 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location4003904-4008445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4008077 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 47 (R47C)
Ref Sequence ENSEMBL: ENSMUSP00000031670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031670]
Predicted Effect probably damaging
Transcript: ENSMUST00000031670
AA Change: R47C

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031670
Gene: ENSMUSG00000032766
AA Change: R47C

DomainStartEndE-ValueType
G_gamma 9 73 2.05e-22 SMART
GGL 12 73 4.61e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the guanine nucleotide-binding protein (G protein) gamma family and encodes a lipid-anchored, cell membrane protein. As a member of the heterotrimeric G protein complex, this protein plays a role in this transmembrane signaling system. This protein is also subject to carboxyl-terminal processing. Decreased expression of this gene is associated with splenic marginal zone lymphomas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,893,194 V32A probably benign Het
Atp8b1 A G 18: 64,546,013 L799S probably damaging Het
Atxn7l1 C T 12: 33,325,953 A82V probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cubn A T 2: 13,479,178 D201E probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Hyal4 T C 6: 24,755,996 V71A probably benign Het
Ighd A T 12: 113,414,548 S144T probably benign Het
Il2rb T C 15: 78,485,004 Y249C probably benign Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lrrc27 C T 7: 139,236,877 S397L probably damaging Het
Ms4a6d T C 19: 11,590,108 E143G probably benign Het
Mtif3 A G 5: 146,958,903 Y125H probably damaging Het
Olfr570 A G 7: 102,901,265 I299M possibly damaging Het
Prkcd G A 14: 30,609,244 T58M possibly damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prpf6 T C 2: 181,645,570 F583L probably benign Het
Prrx1 T C 1: 163,248,262 N245S probably damaging Het
Rfc1 A T 5: 65,272,178 I922N probably damaging Het
Rplp0 T C 5: 115,560,844 V53A probably benign Het
Sis A G 3: 72,908,965 probably null Het
Slc12a1 T C 2: 125,178,102 F411S possibly damaging Het
Slc30a9 G T 5: 67,307,033 probably benign Het
Slc35d2 A G 13: 64,107,043 I207T probably benign Het
Tbc1d14 G T 5: 36,571,843 H60N probably benign Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Zfp981 A G 4: 146,537,368 D250G possibly damaging Het
Other mutations in Gng11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Gng11 APN 6 4004317 start codon destroyed probably null 0.99
R1662:Gng11 UTSW 6 4008066 missense probably benign 0.13
R3037:Gng11 UTSW 6 4008051 missense probably benign 0.19
R3718:Gng11 UTSW 6 4008078 missense probably benign 0.00
R6834:Gng11 UTSW 6 4008068 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCGTCTTAGAGAGTAAGGAAATC -3'
(R):5'- ATTCACACCCCAACTGCTTG -3'

Sequencing Primer
(F):5'- TCTTAGAGAGTAAGGAAATCATGGG -3'
(R):5'- AACTGCTTGGAGAGTGCTTATATGAC -3'
Posted On2020-01-23