Incidental Mutation 'R8020:Lrrc27'
ID617318
Institutional Source Beutler Lab
Gene Symbol Lrrc27
Ensembl Gene ENSMUSG00000015980
Gene Nameleucine rich repeat containing 27
Synonyms1700071K18Rik, 2310044E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8020 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location139212988-139242979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139236877 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 397 (S397L)
Ref Sequence ENSEMBL: ENSMUSP00000016124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016124]
Predicted Effect probably damaging
Transcript: ENSMUST00000016124
AA Change: S397L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016124
Gene: ENSMUSG00000015980
AA Change: S397L

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
LRR_TYP 75 98 1.03e-2 SMART
LRR_TYP 99 122 3.69e-4 SMART
LRR 123 145 7.38e1 SMART
low complexity region 271 283 N/A INTRINSIC
coiled coil region 336 370 N/A INTRINSIC
coiled coil region 463 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,893,194 V32A probably benign Het
Atp8b1 A G 18: 64,546,013 L799S probably damaging Het
Atxn7l1 C T 12: 33,325,953 A82V probably benign Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Cubn A T 2: 13,479,178 D201E probably benign Het
Dao AGG AG 5: 114,015,209 probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gng11 C T 6: 4,008,077 R47C probably damaging Het
Hyal4 T C 6: 24,755,996 V71A probably benign Het
Ighd A T 12: 113,414,548 S144T probably benign Het
Il2rb T C 15: 78,485,004 Y249C probably benign Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Ms4a6d T C 19: 11,590,108 E143G probably benign Het
Mtif3 A G 5: 146,958,903 Y125H probably damaging Het
Olfr570 A G 7: 102,901,265 I299M possibly damaging Het
Prkcd G A 14: 30,609,244 T58M possibly damaging Het
Prm3 CTCTTCTTCTTCTTC CTCTTCTTCTTC 16: 10,790,701 probably benign Het
Prpf6 T C 2: 181,645,570 F583L probably benign Het
Prrx1 T C 1: 163,248,262 N245S probably damaging Het
Rfc1 A T 5: 65,272,178 I922N probably damaging Het
Rplp0 T C 5: 115,560,844 V53A probably benign Het
Sis A G 3: 72,908,965 probably null Het
Slc12a1 T C 2: 125,178,102 F411S possibly damaging Het
Slc30a9 G T 5: 67,307,033 probably benign Het
Slc35d2 A G 13: 64,107,043 I207T probably benign Het
Tbc1d14 G T 5: 36,571,843 H60N probably benign Het
Tmem186 G A 16: 8,636,160 T79I probably damaging Het
Tsga8 A G X: 83,487,098 L135P unknown Het
Zfp981 A G 4: 146,537,368 D250G possibly damaging Het
Other mutations in Lrrc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Lrrc27 APN 7 139227911 intron probably benign
IGL02095:Lrrc27 APN 7 139230253 missense probably benign 0.04
IGL02489:Lrrc27 APN 7 139226061 missense probably benign 0.01
IGL03080:Lrrc27 APN 7 139230237 missense probably benign 0.03
R0372:Lrrc27 UTSW 7 139226187 missense probably benign 0.17
R1466:Lrrc27 UTSW 7 139230308 unclassified probably benign
R2401:Lrrc27 UTSW 7 139223613 missense probably damaging 1.00
R2876:Lrrc27 UTSW 7 139228684 intron probably benign
R3113:Lrrc27 UTSW 7 139218307 missense probably damaging 1.00
R4214:Lrrc27 UTSW 7 139223693 missense probably damaging 1.00
R4707:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R4784:Lrrc27 UTSW 7 139242698 missense probably benign 0.02
R5070:Lrrc27 UTSW 7 139214799 missense probably damaging 0.99
R5855:Lrrc27 UTSW 7 139218335 unclassified probably benign
R6408:Lrrc27 UTSW 7 139218268 missense probably benign 0.14
R6993:Lrrc27 UTSW 7 139242624 missense probably damaging 0.99
R7332:Lrrc27 UTSW 7 139242745 missense probably damaging 1.00
R7350:Lrrc27 UTSW 7 139226106 missense probably benign 0.01
R7460:Lrrc27 UTSW 7 139223658 missense probably damaging 1.00
R7502:Lrrc27 UTSW 7 139214832 missense probably benign
R8071:Lrrc27 UTSW 7 139236986 missense probably benign 0.01
R8518:Lrrc27 UTSW 7 139228774 missense probably benign 0.01
RF018:Lrrc27 UTSW 7 139226100 missense probably benign 0.03
X0065:Lrrc27 UTSW 7 139230245 missense probably benign 0.00
X0065:Lrrc27 UTSW 7 139230246 missense probably benign 0.00
Z1176:Lrrc27 UTSW 7 139242720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCCCTTGATCAACACTG -3'
(R):5'- CTGCTCACATAAGGCTGGACAC -3'

Sequencing Primer
(F):5'- AACCTGTGCTGTTGGGACC -3'
(R):5'- TGGACACTCAGAGGCACTG -3'
Posted On2020-01-23